GYNECOLOGY

Neuroendocrinology

Jul 5, 2016 by in GYNECOLOGY Comments Off on Neuroendocrinology

Neuroendocrinology There are two major sites of action within the brain that are important in the regulation of reproductive function—the hypothalamus and the pituitary gland. In the past, the pituitary…

read more

Regulation of the Menstrual Cycle

Jul 5, 2016 by in GYNECOLOGY Comments Off on Regulation of the Menstrual Cycle

Regulation of the Menstrual Cycle Many superstitious beliefs have surrounded menstruation throughout recorded history. Indeed, attitudes and ideas about this aspect of female physiology have changed slowly. Hopefully, the scientific…

read more

The Uterus

Jul 5, 2016 by in GYNECOLOGY Comments Off on The Uterus

The Uterus Anatomic knowledge of the uterus was slow to accumulate.1,2 Papyrus writings from 2500 B.C. indicate that the ancient Egyptians made a distinction between the vagina and uterus. Because…

read more

The Ovary—Embryology and Development

Jul 5, 2016 by in GYNECOLOGY Comments Off on The Ovary—Embryology and Development

The Ovary—Embryology and Development The great names of early Western medicine were Hippocrates, Soranus, and Galen. Although Aristotle (384-322 B.C.) referred to castration as a common agricultural practice, it was…

read more

Molecular Biology for Clinicians

Jul 5, 2016 by in GYNECOLOGY Comments Off on Molecular Biology for Clinicians

Molecular Biology for Clinicians GCAGCCGTATTTCTACTGCGACGAGGAG GAGAACTTFRITZCTCTACCAGCAGCAG AGCGAGCTSPEROFFAGCCCCGGCGCC CAGGGATATCTGGAAGAAATTCGAGCT CTGCCGCCCTGTCCCTAGCTGCGACGAG The above DNA sequence is obviously a mutant. But the fact that we can recognize this cryptogram as a nucleotide sequence…

read more

Hysterectomy

Jul 2, 2016 by in GYNECOLOGY Comments Off on Hysterectomy

Thomas G. Stovall • Hysterectomy is one of the most commonly performed surgical procedures in the United States. • Vaginal hysterectomy is the procedure of choice in parous women unless…

read more
Get Clinical Tree app for offline access