Neuroendocrinology
Neuroendocrinology There are two major sites of action within the brain that are important in the regulation of reproductive function—the hypothalamus and the pituitary gland. In the past, the pituitary…
Regulation of the Menstrual Cycle
Regulation of the Menstrual Cycle Many superstitious beliefs have surrounded menstruation throughout recorded history. Indeed, attitudes and ideas about this aspect of female physiology have changed slowly. Hopefully, the scientific…
The Uterus
The Uterus Anatomic knowledge of the uterus was slow to accumulate.1,2 Papyrus writings from 2500 B.C. indicate that the ancient Egyptians made a distinction between the vagina and uterus. Because…
Hormone Biosynthesis, Metabolism, and Mechanism of Action
Hormone Biosynthesis, Metabolism, and Mechanism of Action The classical definition of a hormone is a substance that is produced in a special tissue, where it is released into the bloodstream,…
The Ovary—Embryology and Development
The Ovary—Embryology and Development The great names of early Western medicine were Hippocrates, Soranus, and Galen. Although Aristotle (384-322 B.C.) referred to castration as a common agricultural practice, it was…
Molecular Biology for Clinicians
Molecular Biology for Clinicians GCAGCCGTATTTCTACTGCGACGAGGAG GAGAACTTFRITZCTCTACCAGCAGCAG AGCGAGCTSPEROFFAGCCCCGGCGCC CAGGGATATCTGGAAGAAATTCGAGCT CTGCCGCCCTGTCCCTAGCTGCGACGAG The above DNA sequence is obviously a mutant. But the fact that we can recognize this cryptogram as a nucleotide sequence…
