Introduction
The onset of uterine labor is the culmination of a gradual uterine activation wherein physiological inflammation induces a common prolabor pathway characterized by increased myometrial contractility, weakening of fetal membrane integrity, and cervical ripening. Pathological proinflammatory stimuli, as observed in numerous etiologies of preterm birth (PTB), can induce ≥1 of the components of this common pathway resulting in preterm labor and is sufficiently pronounced to induce fetal/neonatal damage as has often been reported ; PTB is a leading cause of neonatal mortality and morbidity worldwide.
During labor metabolic demand increases beyond tissue oxygenation capacity. To sustain the vigorous contractions of the myometrium, glycogen and glucose are utilized by myometrial smooth muscle cells (mSMC) to produce ATP under relative anaerobic conditions, leading to the accumulation of intermediates of carbohydrate metabolites, including lactate. This anaerobic glycolytic metabolic pathway is extremely active (high lactate/pyruvate ratio) in myometrium during labor. Accordingly, blood lactate levels of laboring women increase considerably as a function of the duration of labor.
Lately, lactate has been demonstrated to activate a G protein-coupled receptor, GPR81 (also labeled HCA 1 ). This suggests that lactate has unexpected signaling functions beyond its traditional metabolic role. Along these lines, a role for lactate in the regulation of inflammation has been reported wherein lactate-induced stimulation of GPR81 in leukocytes specifically inhibited the inflammasome, an important proinflammatory system active during labor ; correspondingly, a tocolytic function for lactate has been postulated. We thus proceeded to study the role of lactate and GPR81 in the uterus during labor. Herein, we describe a novel role for lactate in regulating inflammation during labor via activation of GPR81 in the uterus.
Materials and Methods
Experimental design
This study was designed to address the pharmacological role of lactate via its cognate receptor GPR81 in the uterus during labor, with a particular focus on its potential contribution to the intrauterine inflammatory environment of labor. Loss-of-function experiments were designed to acquire direct evidence of the effect of GPR81 in the uterus using GPR81 –/– and GPR81 knocked-down mice. Specifically, we investigated the expression of GPR81 in the uterus during pregnancy using antibody-based methods, namely immunohistochemistry and immunoblotting. The transcriptional induction of genes of key inflammatory mediators (eg, Il6 , Ccl2 , Pghs2 ; see Table 1 for primer sequences) in response to GPR81 stimulation (with lactate or the specific GPR81 agonist 3,5-dihydroxybenzoic acid [DHBA]), and with the addition of the major proinflammatory stimulant interleukin (IL)-1β, was measured ex vivo in uterus explants, in vitro in isolated mSMC, and in vivo in pregnant mice in labor. This set of experiments was designed to assess the potential antiinflammatory effect of uterine GPR81 when stimulated with exogenous lactate and 3,5-DHBA, or endogenous lactate during labor. A widely used lipopolysaccharide (LPS)-induced PTB model was utilized to investigate the therapeutic potential of GPR81 stimulation as a mean to decrease uterine inflammation and consequently prevent preterm labor and neonatal mortality.
| A forward: TTGACCGAGCAGAACAAGATG | A reverse: CATCTTGTTCTGCTCGGTCAA |
|---|---|
| B forward: AAGATGACCAAAGTCCAGAGG | B reverse: CCTCTGGACTTTGGTCATCTT |
| C forward: AAATAGTGCTTGACTTCCAGG | C reverse: CCTGGAAGTCAAGCACTATTT |
Animals
Timed-pregnant CD-1 mice were obtained from Charles River Inc (Senneville, Montreal, Québec, Canada) at G11 and allowed to acclimatize for 2 days prior to experiments. Animals were used according to a protocol of the Animal Care Committee of Hospital Sainte-Justine along the principles of the Guide for the Care and Use of Experimental Animals of the Canadian Council on Animal Care. The animals were maintained on standard laboratory chow under a 12:12 light:dark cycle and allowed free access to chow and water. GPR81 –/– mice were obtained from Lexicon Pharmaceuticals (The Woodlands, TX). The gestational time of GPR81 –/– and wild-type (WT) mice was monitored every 2 hours.
Chemicals
Chemicals were purchased from the following manufacturers: rhIL-1β (no. 200-01B; PeproTech, Quebec, Canada), lactate (no. L1750; Sigma, Oakville, Ontario, Canada), β-estradiol (no. 2758; Sigma), 3,5-DHBA (no. 54965; Sigma), and LPS Escherichia coli strain 0111:B4 (no. L2360; Sigma).
Lentivirus production and intrauterine injection
We produced infectious lentivirus (LV) by transiently transfecting lentivector and packaging vectors into 293FT cells (Invitrogen, Thermo Fischer Scientific, Burlington, Ontario, Canada) as previously described. We used 5 different small hairpin RNA sequences against Gpr81 (RMM4534-EG243270; Dharmacon, GE Healthcare Life Sciences, Lafayette, CO) (see Table 1 for sequences) and selected the most effective ( Supplementary Figure 4 , A). In vivo infections were performed in pregnant mice at G13 with a single intrauterine injection. Briefly, pregnant mice were steadily anesthetized with an isoflurane mask. After body hair removal from the peritoneal area, a 1.5-cm long median incision was made with surgical scissors in the lower abdominal wall. In all, 50 μL of vehicle, LV.shGFP, or LV.shGPR81 was injected in the lower segment of both uterine horns (100 μL total) between 2 fetal membranes with care to not enter the amniotic cavity. The abdominal muscle layer was then sutured and the skin closed with clips. LV were allowed to infect the uterus for 72 hours.
LPS-induced PTB model
Timed-pregnant CD-1 mice were carefully randomized by generating computer-aided randomized numbers for total animals, which were subsequently assigned to the indicated treatment groups as explained earlier. Mice were pretreated at G13 with an intrauterine injection of vehicle (n = 16), LV.shGFP (n = 12), or LV.shGPR81 (n = 15) (described in the section above). At G16, these animals were anesthetized with isoflurane and received an intraperitoneal injection of E coli –derived LPS (single dose of 10 μg in 100 μL of saline); space limitations precluded performing these experiments in GPR81 knockout mice, as these studies require a large number of colonies. In other experiments, mice received only the LPS injection without a prior LV intrauterine injection. In all, 100 μL of pH-balanced 3,5-DHBA (25 mg/kg/8 hours) (n = 20) or vehicle (n = 36) was injected into these animals subcutaneously (in the neck skin) 30 minutes before LPS or vehicle stimulation (to allow distribution of the drug to target tissues in a preclinical efficacy study). The LPS-induced PTB model used was selected on the basis of reported documentation. For both experiments, deliveries were monitored hourly until term (>G19). During labor (as confirmed with vaginal bleeding and newborns in the nest), female adults were anesthetized and uterine fragments from their lower uterus (cervical side) were collected, snap-frozen in liquid nitrogen, and kept at –80°C for subsequent RNA purification. In some cases ( Figure 5 ), randomized mice (selected on the same basis described above) were allowed to fully deliver to assess neonatal mortality.
Intrauterine IL-1β-induced PTB model
Timed-pregnant CD-1 mice at G16 were steadily anesthetized with an isoflurane mask. After body hair removal from the peritoneal area, a 1.5-cm long median incision was made with surgical scissors in the lower abdominal wall. The lower segment of the right uterine horn was then exposed and 1 μg of IL-1β was injected between 2 fetal membranes with care to not enter the amniotic cavity. The abdominal muscle layer was sutured and the skin closed with clips.
Primary mSMC and uterine explant isolation and culture
Primary mSMC and uterine explants were isolated from WT and GPR81 –/– animals using modifications of a method previously described. Briefly, a single subcutaneous injection of 50 μg 17β-estradiol was administered to mice 24 hours prior to the experiment. The day after, mice were sacrificed by cervical dislocation and sprayed with 70% ethanol. The whole uterus was excised under a sterile hood and placed in Hank’s balanced salt solution, 100 U/mL penicillin-streptomycin (Gibco, Grand Island, NY), and 2.5 μg/mL amphotericin B (Sigma). The uterine horns were cleansed of fat and vessels and washed by gentle flushing. For explant culture, the uterine horns (including endometrium) were cut into 5-mm long fragments and immediately incubated in DMEM medium supplemented with 10% serum for 1 hour at 37°C and 5% carbon dioxide (with sufficient volume to completely cover the tissue). Explants were then serum-starved for an additional 1 hour and stimulated with 5 ng/mL IL-1β and/or 10 mmol/L lactate (pH-balanced) or 100 μmol/L 3,5-DHBA for 8 hours and frozen at –80°C for subsequent messenger RNA (mRNA) isolation. Lactate and 3,5-DHBA were added 30 minutes prior to IL-1β stimulation. For primary mSMC culture, the uterine horns were cut into 1-mm wide fragments and transferred into a volume of 10 mL/g of tissue of digestion buffer (1 mg/mL collagenase type II [Sigma], 0.15 mg/mL deoxyribonuclease I [Roche Diagnostics GmbH, Mannheim, Germany], 0.1 mg/mL soybean trypsin inhibitor [Sigma], 10% FBS, and 1 mg/mL bovine serum albumin [Sigma] in Hank’s balanced salt solution). Enzymatic digestion was performed at 37°C with agitation (100 rpm) for 30 minutes. The homogenate (still containing undigested myometrium fragments) was then poured through a 100-μm cell strainer. The resulting filtered solution was centrifuged at 200 g for 10 minutes; the pellet was resuspended in complete DMEM medium and plated in a T-25 dish. The remaining myometrium fragments were re-used in an enzymatic digestion and the whole digestion-centrifugation process was repeated a total of 5 times. The first 2 digestion results were discarded because they contained mostly fibroblasts. The 3 other smooth muscle cell–containing dishes were subjected to a differential adhesion technique to selectively enrich for uterine myocytes. Briefly, 30-45 minutes after the cells were first plated, the medium was removed and dispensed in another T-25 culture dish to separate quickly adhering fibroblast from slowly adhering myocytes. Cells were further analyzed in immunohistochemistry to assess culture purity with the smooth muscle cell marker α-actin ( Supplementary Figure 2 ).
Cell culture
Primary murine mSMC or human mSMC (hTERT cell line) were cultured in DMEM growth medium supplemented with 10% serum, 50 U/mL penicillin, and 50 mg/mL streptomycin. Cells were propagated in regular conditions (37°C, 5% carbon dioxide). For in vitro experiments, cells (serum-starved overnight) or freshly isolated uterine fragments from WT or GPR81 –/– mice were treated with 5 ng/mL IL-1β and/or 10 mmol/L lactate (pH-balanced) or 100 μmol/L 3,5-DHBA for 8 hours. Lactate and 3,5-DHBA were added 30 minutes prior to IL-1β stimulation. Cells and tissues were then collected in Ribozol (AMRESCO, Solon, OH) and stored at –80°C for mRNA extraction.
RNA extraction and real-time quantitative polymerase chain reaction
RNA from tissues (from ex vivo stimulation [described above] or collected during pregnancy) or cells was extracted according to manufacturer’s protocol. The RNA concentration and integrity were measured with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). RNA (500 ng) was used to synthesize cDNA using iScript Reverse Transcription SuperMix (Bio-Rad, Hercules, CA). Primers were designed using Primer Blast (National Center for Biotechnology Information) ( Table 2 ). Quantitative gene expression analysis was performed on MXPro3000 (Stratagene) with SYBR Green Master Mix (Bio-Rad). Gene expression levels were normalized to 18S universal primer (Ambion Life Technology, Burlington, Ontario, Canada). Dissociation curves were also acquired to test primer specificity. Genes analyzed included: Il1b , Il4 , Il6 , Il8 , Ccl2 (chemokine ligand 2), Ptghs2 (prostaglandin H synthetase 2 or COX-2), Oxtr (oxytocin receptor), Mmp9 (metalloproteinase 9), Crp (C-reactive protein), Gja1 (connexin 43), and Gpr81 .
| Mouse primers | |
|---|---|
| IL-1B-F: AGATGAAGGGCTGCTTCCAAA | IL-1B-R: GGAAGGTCCACGGGAAAGAC |
| IL-4-F: AACGAAGAACACCACAGAGAG | IL-4-R: GTGATGTGGACTTGGACTCA |
| IL-6-F: CAACGATGATGCACTTGCAGA | IL-6-R: TCTCTCTGAAGGACTCTGGCT |
| IL-8-F: TGCTTTTGGCTTTGCGTTGA | IL-8-R: GTCAGAACGTGGCGGTATCT |
| IL-10-F: TAACTGCACCCACTTCCCAG | IL-10-R: AGGCTTGGCAACCCAAGTAA |
| TNFA-F: GCCTCTTCTCATTCCTGCTTG | TNFA-R: CTGATGAGAGGGAGGCCATT |
| MMP1A-F: CAGGACTTATATGGACCTTCCC | MMP1A-R: TAAATTGAGCTCAGGTTCTGGC |
| MMP3-F: GTGACCCCACTCACTTTCTC | MMP3-R: TTGGTACCAGTGACATCCTCT |
| MMP9-F: TCAAGGACGGTTGGTACTGG | MMP9-R: CTGACGTGGGTTACCTCTGG |
| OXTR-F: TGTGTCTCCTTTTGGGACAA | OXTR-R: GGCATTTCAGAATTGGCTGT |
| PGHS2-F: ACCTCTCCACCAATGACCTGA | PGHS2-R: CTGACCCCCAAGGCTCAAAT |
| PTGFR-F: AGCTGGACTCATCGCAAACA | PTGFR-R: GTGGGCACAAGCCAGAAAAG |
| GJA1-F: GCACTTTTCTTTCATTGGGGG | GJA1-R: GGGCACCTCTCTTTCACTTA |
| CCL2-F: GCTCAGCCAGATGCAGTTA | CCL2-R: TGTCTGGACCCATTCCTTCT |
| GPR81-F: CCGGTTCATCATGGTGGTGGCT | GPR81-R: CTCTTCTGACCTCCGCGTCTTC |
Semiquantitative polymerase chain reaction
hTERT myometrial cells were pretreated with LV.shGFP or 3 different forms of shRNA encoded in LV (LV.shGPR81A,B,C) for 72 hours to verify efficacy of the latter in knocking down GPR81. Total RNA was isolated with RNase TM mini kit (Qiagen, Germantown, MD). Real-time polymerase chain reaction (only used to verify efficacy of shRNA) was performed as described previously. QuantumRNA universal 18S standard primers (Ambion) were used as internal standard references. LV.shGPR81B was used in vivo to effectively knock down GPR81. Note that all other measurements of mRNA were performed by quantitative polymerase chain reaction.
Western blotting
Proteins from homogenized myometrium fragments collected during pregnancy lysed in RIPA buffer containing protease inhibitors were quantified using Bradford method (Bio-Rad). A total of 50 μg of protein sample were loaded onto sodium dodecyl sulfate polyacrylamide gel electrophoresis and electrotransferred onto PVDF membranes. After blocking, membranes were incubated with an antibody against GPR81 (#SAB1300790, Sigma-Aldrich, Oakville, Ontario, Canada) After washing, membranes were incubated for 1 hour with their respective secondary antibodies conjugated to HRP (Sigma). Enhanced chemiluminescence (GE Healthcare, Little Chalfont, United Kingdom) was used for detection using the ImageQuant LAS-500 (GE Healthcare).
Lactate quantification assay
Age-matched laboring pregnant mice at term or nonlaboring pregnant mice at term were sacrificed and their uteri were snap-frozen in liquid nitrogen and stored at –80°C for <1 month. A fragment of 400 mg of each uterus was homogenized and used to quantify tissue lactate concentration using a colorimetric assay following manufacturer’s protocol (K627; BioVision, Milpitas, CA). Readings were made on a microplate reader (EnVision Multilabel reader; PerkinElmer, Waltham, MA) adjusted for 450 nm. A standard curve of nmol/well vs OD450 nm was plotted and sample readings were applied and calculated using C = La/Sv (nmol/μL or mmol/L); where La = lactic acid amount (nmol) of sample from standard curve, and Sv = sample volume (μL) added into the well. Results were then converted into a concentration unit (mmol/L) using the above standard curve. Interassay variation (for standards) is 0.5 mmol/L (based on laboratory and manufacturer).
Immunohistochemistry
mSMC were plated on coverslips precoated with poly-D-lysine and fixed in 4% paraformaldehyde. After blocking, cells were incubated overnight with rabbit anti-α-actin (no. ab5694; Abcam, Toronto, Ontario, Canada) and then for 1 hour at ambient temperature with a secondary antibody conjugated with Alexa Fluor 488 (green) (Thermo Fisher Scientific). For tissue immunohistochemistry, uteri from pregnant mice in labor and nonpregnant mice were cleansed of fat and vessels and fixed in 4% paraformaldehyde for 1 day and transferred in 30% sucrose for another day. Localization of GPR81 was determined on 14-μm uterine sagittal cryosections. Sections blocked with 1% bovine serum albumin, 1% goat serum, and 0.1% Triton X-100 (T-8787; Sigma) in PBS were subsequently incubated overnight with the primary antibodies. Secondary antibodies conjugated with Alexa Fluor (Thermo Fisher Scientific) directed against rabbit were incubated for 2 hours at ambient temperature. Nuclei were stained with DAPI (1/5000) (Invitrogen). Images were captured using ×10 (for whole uterus imaging) or ×30 (for cell and magnified uterus imaging) objective with Eclipse E800 fluorescence microscope (Nikon, Mississauga, Ontario, Canada). Whole uterine images were captured using an AxioObserver.Z1 (Zeiss, San Diego, CA). Images were merged into a single file using the MosiaX option in AxioVision software, Version 4.6.5 (Zeiss).
Statistical analysis
Groups were compared by 1-way analysis of variance. Dunnett multiple comparison method was employed when treatments were compared to a single control. A value of P < .05 was considered statistically significant. Data are presented as means ± SEM.
Materials and Methods
Experimental design
This study was designed to address the pharmacological role of lactate via its cognate receptor GPR81 in the uterus during labor, with a particular focus on its potential contribution to the intrauterine inflammatory environment of labor. Loss-of-function experiments were designed to acquire direct evidence of the effect of GPR81 in the uterus using GPR81 –/– and GPR81 knocked-down mice. Specifically, we investigated the expression of GPR81 in the uterus during pregnancy using antibody-based methods, namely immunohistochemistry and immunoblotting. The transcriptional induction of genes of key inflammatory mediators (eg, Il6 , Ccl2 , Pghs2 ; see Table 1 for primer sequences) in response to GPR81 stimulation (with lactate or the specific GPR81 agonist 3,5-dihydroxybenzoic acid [DHBA]), and with the addition of the major proinflammatory stimulant interleukin (IL)-1β, was measured ex vivo in uterus explants, in vitro in isolated mSMC, and in vivo in pregnant mice in labor. This set of experiments was designed to assess the potential antiinflammatory effect of uterine GPR81 when stimulated with exogenous lactate and 3,5-DHBA, or endogenous lactate during labor. A widely used lipopolysaccharide (LPS)-induced PTB model was utilized to investigate the therapeutic potential of GPR81 stimulation as a mean to decrease uterine inflammation and consequently prevent preterm labor and neonatal mortality.
| A forward: TTGACCGAGCAGAACAAGATG | A reverse: CATCTTGTTCTGCTCGGTCAA |
|---|---|
| B forward: AAGATGACCAAAGTCCAGAGG | B reverse: CCTCTGGACTTTGGTCATCTT |
| C forward: AAATAGTGCTTGACTTCCAGG | C reverse: CCTGGAAGTCAAGCACTATTT |
Animals
Timed-pregnant CD-1 mice were obtained from Charles River Inc (Senneville, Montreal, Québec, Canada) at G11 and allowed to acclimatize for 2 days prior to experiments. Animals were used according to a protocol of the Animal Care Committee of Hospital Sainte-Justine along the principles of the Guide for the Care and Use of Experimental Animals of the Canadian Council on Animal Care. The animals were maintained on standard laboratory chow under a 12:12 light:dark cycle and allowed free access to chow and water. GPR81 –/– mice were obtained from Lexicon Pharmaceuticals (The Woodlands, TX). The gestational time of GPR81 –/– and wild-type (WT) mice was monitored every 2 hours.
Chemicals
Chemicals were purchased from the following manufacturers: rhIL-1β (no. 200-01B; PeproTech, Quebec, Canada), lactate (no. L1750; Sigma, Oakville, Ontario, Canada), β-estradiol (no. 2758; Sigma), 3,5-DHBA (no. 54965; Sigma), and LPS Escherichia coli strain 0111:B4 (no. L2360; Sigma).
Lentivirus production and intrauterine injection
We produced infectious lentivirus (LV) by transiently transfecting lentivector and packaging vectors into 293FT cells (Invitrogen, Thermo Fischer Scientific, Burlington, Ontario, Canada) as previously described. We used 5 different small hairpin RNA sequences against Gpr81 (RMM4534-EG243270; Dharmacon, GE Healthcare Life Sciences, Lafayette, CO) (see Table 1 for sequences) and selected the most effective ( Supplementary Figure 4 , A). In vivo infections were performed in pregnant mice at G13 with a single intrauterine injection. Briefly, pregnant mice were steadily anesthetized with an isoflurane mask. After body hair removal from the peritoneal area, a 1.5-cm long median incision was made with surgical scissors in the lower abdominal wall. In all, 50 μL of vehicle, LV.shGFP, or LV.shGPR81 was injected in the lower segment of both uterine horns (100 μL total) between 2 fetal membranes with care to not enter the amniotic cavity. The abdominal muscle layer was then sutured and the skin closed with clips. LV were allowed to infect the uterus for 72 hours.
LPS-induced PTB model
Timed-pregnant CD-1 mice were carefully randomized by generating computer-aided randomized numbers for total animals, which were subsequently assigned to the indicated treatment groups as explained earlier. Mice were pretreated at G13 with an intrauterine injection of vehicle (n = 16), LV.shGFP (n = 12), or LV.shGPR81 (n = 15) (described in the section above). At G16, these animals were anesthetized with isoflurane and received an intraperitoneal injection of E coli –derived LPS (single dose of 10 μg in 100 μL of saline); space limitations precluded performing these experiments in GPR81 knockout mice, as these studies require a large number of colonies. In other experiments, mice received only the LPS injection without a prior LV intrauterine injection. In all, 100 μL of pH-balanced 3,5-DHBA (25 mg/kg/8 hours) (n = 20) or vehicle (n = 36) was injected into these animals subcutaneously (in the neck skin) 30 minutes before LPS or vehicle stimulation (to allow distribution of the drug to target tissues in a preclinical efficacy study). The LPS-induced PTB model used was selected on the basis of reported documentation. For both experiments, deliveries were monitored hourly until term (>G19). During labor (as confirmed with vaginal bleeding and newborns in the nest), female adults were anesthetized and uterine fragments from their lower uterus (cervical side) were collected, snap-frozen in liquid nitrogen, and kept at –80°C for subsequent RNA purification. In some cases ( Figure 5 ), randomized mice (selected on the same basis described above) were allowed to fully deliver to assess neonatal mortality.
Intrauterine IL-1β-induced PTB model
Timed-pregnant CD-1 mice at G16 were steadily anesthetized with an isoflurane mask. After body hair removal from the peritoneal area, a 1.5-cm long median incision was made with surgical scissors in the lower abdominal wall. The lower segment of the right uterine horn was then exposed and 1 μg of IL-1β was injected between 2 fetal membranes with care to not enter the amniotic cavity. The abdominal muscle layer was sutured and the skin closed with clips.
Primary mSMC and uterine explant isolation and culture
Primary mSMC and uterine explants were isolated from WT and GPR81 –/– animals using modifications of a method previously described. Briefly, a single subcutaneous injection of 50 μg 17β-estradiol was administered to mice 24 hours prior to the experiment. The day after, mice were sacrificed by cervical dislocation and sprayed with 70% ethanol. The whole uterus was excised under a sterile hood and placed in Hank’s balanced salt solution, 100 U/mL penicillin-streptomycin (Gibco, Grand Island, NY), and 2.5 μg/mL amphotericin B (Sigma). The uterine horns were cleansed of fat and vessels and washed by gentle flushing. For explant culture, the uterine horns (including endometrium) were cut into 5-mm long fragments and immediately incubated in DMEM medium supplemented with 10% serum for 1 hour at 37°C and 5% carbon dioxide (with sufficient volume to completely cover the tissue). Explants were then serum-starved for an additional 1 hour and stimulated with 5 ng/mL IL-1β and/or 10 mmol/L lactate (pH-balanced) or 100 μmol/L 3,5-DHBA for 8 hours and frozen at –80°C for subsequent messenger RNA (mRNA) isolation. Lactate and 3,5-DHBA were added 30 minutes prior to IL-1β stimulation. For primary mSMC culture, the uterine horns were cut into 1-mm wide fragments and transferred into a volume of 10 mL/g of tissue of digestion buffer (1 mg/mL collagenase type II [Sigma], 0.15 mg/mL deoxyribonuclease I [Roche Diagnostics GmbH, Mannheim, Germany], 0.1 mg/mL soybean trypsin inhibitor [Sigma], 10% FBS, and 1 mg/mL bovine serum albumin [Sigma] in Hank’s balanced salt solution). Enzymatic digestion was performed at 37°C with agitation (100 rpm) for 30 minutes. The homogenate (still containing undigested myometrium fragments) was then poured through a 100-μm cell strainer. The resulting filtered solution was centrifuged at 200 g for 10 minutes; the pellet was resuspended in complete DMEM medium and plated in a T-25 dish. The remaining myometrium fragments were re-used in an enzymatic digestion and the whole digestion-centrifugation process was repeated a total of 5 times. The first 2 digestion results were discarded because they contained mostly fibroblasts. The 3 other smooth muscle cell–containing dishes were subjected to a differential adhesion technique to selectively enrich for uterine myocytes. Briefly, 30-45 minutes after the cells were first plated, the medium was removed and dispensed in another T-25 culture dish to separate quickly adhering fibroblast from slowly adhering myocytes. Cells were further analyzed in immunohistochemistry to assess culture purity with the smooth muscle cell marker α-actin ( Supplementary Figure 2 ).
Cell culture
Primary murine mSMC or human mSMC (hTERT cell line) were cultured in DMEM growth medium supplemented with 10% serum, 50 U/mL penicillin, and 50 mg/mL streptomycin. Cells were propagated in regular conditions (37°C, 5% carbon dioxide). For in vitro experiments, cells (serum-starved overnight) or freshly isolated uterine fragments from WT or GPR81 –/– mice were treated with 5 ng/mL IL-1β and/or 10 mmol/L lactate (pH-balanced) or 100 μmol/L 3,5-DHBA for 8 hours. Lactate and 3,5-DHBA were added 30 minutes prior to IL-1β stimulation. Cells and tissues were then collected in Ribozol (AMRESCO, Solon, OH) and stored at –80°C for mRNA extraction.
RNA extraction and real-time quantitative polymerase chain reaction
RNA from tissues (from ex vivo stimulation [described above] or collected during pregnancy) or cells was extracted according to manufacturer’s protocol. The RNA concentration and integrity were measured with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). RNA (500 ng) was used to synthesize cDNA using iScript Reverse Transcription SuperMix (Bio-Rad, Hercules, CA). Primers were designed using Primer Blast (National Center for Biotechnology Information) ( Table 2 ). Quantitative gene expression analysis was performed on MXPro3000 (Stratagene) with SYBR Green Master Mix (Bio-Rad). Gene expression levels were normalized to 18S universal primer (Ambion Life Technology, Burlington, Ontario, Canada). Dissociation curves were also acquired to test primer specificity. Genes analyzed included: Il1b , Il4 , Il6 , Il8 , Ccl2 (chemokine ligand 2), Ptghs2 (prostaglandin H synthetase 2 or COX-2), Oxtr (oxytocin receptor), Mmp9 (metalloproteinase 9), Crp (C-reactive protein), Gja1 (connexin 43), and Gpr81 .
