Maternal melatonin or N-acetylcysteine therapy regulates hydrogen sulfide-generating pathway and renal transcriptome to prevent prenatal N G-Nitro-L-arginine-methyl ester (L-NAME)-induced fetal programming of hypertension in adult male offspring




Background


Pregnancy is a critical time for fetal programming of hypertension. Nitric oxide deficiency during pregnancy causes hypertension in adult offspring.


Objective


We examined whether maternal melatonin or N-acetylcysteine therapy can prevent N G -nitro-L-arginine-methyl ester–induced fetal programming of hypertension in adult offspring. Next, we aimed to identify potential gatekeeper pathways that contribute to N G -nitro-L-arginine-methyl ester –induced programmed hypertension using the next generation RNA sequencing technology.


Study Design


Pregnant Sprague-Dawley rats were assigned to 4 groups: control, N G -nitro-L-arginine-methyl ester, N G -nitro-L-arginine-methyl ester +melatonin, and N G -nitro-L-arginine-methyl ester+N-acetylcysteine. Pregnant rats received N G -nitro-L-arginine-methyl ester administration at 60 mg/kg/d subcutaneously during pregnancy alone, with additional 0.01% melatonin in drinking water, or with additional 1% N-acetylcysteine in drinking water during the entire pregnancy and lactation. Male offspring (n=8/group) were killed at 12 weeks of age.


Results


N G -nitro-L-arginine-methyl ester exposure during pregnancy induced programmed hypertension in adult male offspring, which was prevented by maternal melatonin or N-acetylcysteine therapy. Protective effects of melatonin and N-acetylcysteine against N G -nitro-L-arginine-methyl ester–induced programmed hypertension were associated with an increase in hydrogen sulfide–generating enzymes and hydrogen sulfide synthesis in the kidneys. Nitric oxide inhibition by N G -nitro-L-arginine-methyl ester in pregnancy caused >2000 renal transcripts to be modified during nephrogenesis stage in 1-day-old offspring kidney. Among them, genes belong to the renin-angiotensin system, and arachidonic acid metabolism pathways were potentially involved in the N G -nitro-L-arginine-methyl ester–induced programmed hypertension. However, melatonin and N-acetylcysteine reprogrammed the renin-angiotensin system and arachidonic acid pathway differentially.


Conclusion


Our results indicated that antioxidant therapy, by melatonin or N-acetylcysteine, in pregnant rats with nitric oxide deficiency can prevent programmed hypertension in male adult offspring. Early intervention with specific antioxidants that target redox imbalance in pregnancy to reprogram hypertension may well allow us to reduce the future burden of hypertension. The roles of transcriptome changes that are induced by N G -nitro-L-arginine-methyl ester in the offspring kidney require further clarification.


Nitric oxide (NO), a potent vasodilator, regulates fetoplacental blood flow, organogenesis, and fetal growth. NO deficiency is related to preeclampsia, gestational hypertension, and programmed hypertension in the offspring. In utero reactive oxygen species (ROS) that are generated by a variety of suboptimal conditions are key downstream mediators that initiate the programming of the offspring. The developing kidney is particularly susceptible to the insults of programming. Accumulating evidence indicates that decreased NO bioavailability and increased ROS that causes oxidative stress in the kidney are present in various experimental models of programmed hypertension. Our recent work demonstrated that that ROS/NO imbalance is involved in the development of hypertension in different developmental models, such as maternal caloric restriction, maternal diabetes mellitus, and the prenatal dexamethasone exposure model.


We previously showed that the inhibition of the NO synthase (NOS) with N G -nitro-L-arginine-methyl ester (L-NAME) during pregnancy induced programmed hypertension in male offspring at 12 weeks of age, which was prevented by maternal L-citrulline supplementation. Asymmetric dimethylarginine (ADMA) is an endogenous inhibitor of NOS. Elevated ADMA levels that lead to an imbalanced ADMA-NO pathway are related to compromised pregnancy, fetal programming, and programmed hypertension. Although maternal L-citrulline supplementation decreased ADMA concentration and restored ADMA/NO balance to prevent the programming of hypertension, whether other antioxidants can prevent maternal L-NAME exposure-induced programmed hypertension via restoration the ADMA-NO pathway and NO-redox balance remains unclear.


Melatonin and its metabolites have both direct radical scavenging effects and indirect antioxidant actions. Given that melatonin can reverse oxidative stress during the prenatal period, melatonin has been shown to be a reprogramming strategy. We found that prenatal melatonin therapy offsets the effects of maternal caloric restriction–induced programmed hypertension in adult offspring.


Next, N-acetylcysteine (NAC), a glutathione prodrug and precursor of L-cysteine, has been shown to reduce oxidative stress. Hydrogen sulfide (H 2 S), a vasodilator like NO, is known to be produced from L-cysteine by cystathionine β-synthase (CBS), cystathionine γ-lyase (CSE), and 3-mercaptopyruvate sulfurtransferase (3MST). Our recent findings indicated that maternal NAC therapy protects adult offspring against prenatal dexamethasone and postnatal high-fat–induced programmed hypertension and oxidative stress. Therefore, we first determined whether melatonin or NAC can protect the adult offspring against prenatal L-NAME–induced programmed hypertension. Next, we also aimed to identify potential gatekeeper pathways that contribute to L-NAME–induced programmed hypertension in 1-day-old offspring kidney using the next-generation sequencing (NGS) analysis.


Material and Methods


Animal models


This study was approved by the Institutional Animal Care and Use Committee of the Kaohsiung Chang Gung Memorial Hospital. Virgin Sprague-Dawley rats (12–16 weeks old) were obtained from BioLASCO Taiwan Co, Ltd (Taipei, Taiwan) and were housed and maintained in a facility that was accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. Male Sprague-Dawley rats were caged with individual females until mating was confirmed by observation of a vaginal plug. Pregnant rats (n=9) received L-NAME administration at 60 mg/kg/d by a subcutaneous osmotic pump (Alza Corporation, Palo Alto, CA) during the whole period of pregnancy. Pregnant rats (n=3) that received continuous infusion of isosmotic saline solution were used as controls. Three of the L-NAME–treated rats received 0.01% melatonin (L-NAME+M) in drinking water during the entire pregnancy and lactation (ie, a total of 6 weeks) to cover the entire nephrogenesis. Melatonin was prepared twice weekly by dissolving the drug (10 mg) in 1 mL of 100% ethanol. This solution was then diluted with water to a final concentration of 0.01%. Water bottles were wrapped with aluminum foil to protect them from the light. Three of the L-NAME–treated rats received 1% NAC (L-NAME+NAC) in drinking water during the entire pregnancy and lactation. The doses of melatonin and NAC that were used here were based on our previous studies conducted in rats. Given that hypertension occurs at a higher rate and at an earlier age in males than females, only male offspring were selected from each litter and used in subsequent experiments. One-half of them were killed at birth for an NGS study which left 32 pups available. After birth, the subjects that came from litters were culled to 8 pups to standardize the received quantity of milk and maternal pup care. Male pups were assigned to 4 groups (n=8/group): control, L-NAME, L-NAME+M, and L-NAME+NAC.


Blood pressure (BP) was measured in conscious rats by an indirect tail-cuff method (BP-2000; Visitech Systems, Inc, Apex, NC) after they had been trained systematically. To ensure accuracy and reproducibility, the rats were acclimated to restraint and tail-cuff inflation for 1 week before the experiment. Three stable measurements were obtained and were averaged. The remaining rats were killed at 12 weeks of age. Heparinized blood samples were collected, and the kidneys were harvested and stored at –80°C freezer for further analysis. The H 2 S-producing capacity of the kidney was measured as previously described. The tissue concentration was factored for the protein concentration, which was represented as micromoles per gram of protein per minute. Plasma levels of NOx; NO 2 − + NO 3 − were measured by the Griess reaction, as previously described. Renal 8-isoprostane level, a marker of oxidative stress, was measured with an enzyme-linked immunosorbent assay kit (Cayman, Ann Arbor, MI), according to the manufacturer’s protocol.


High-performance liquid chromatography


Plasma L-arginine, L-citrulline, ADMA, and symmetric dimethylarginine (SDMA; a stereoisomer of ADMA) levels were measured using high-performance liquid chromatography (HP series 1100; Agilent Technologies, Inc, Santa Clara, CA) with the OPA-3MPA derivatization reagent, as we described previously. Standards contained L-arginine, L-citrulline, ADMA, and SDMA in the range of 1–100 μM, 1–100 μM, 0.5–5 μM, and 0.5–5 μM, respectively. The tissue concentration was factored for protein concentration, which was represented as micromoles per milligrams of protein. Plasma L-cysteine and glutathione levels were also measured using high-performance liquid chromatography.


Western blot


Western blot analysis was performed as previously described. We used the following antibodies: a mouse monoclonal anti-neuronal NOS antibody (1:200 dilution, overnight incubation; Santa Cruz Biotechnology Inc, Santa Cruz, CA), a mouse monoclonal anti-endothelial NOS antibody (1:250 dilution, 1-hour incubation; Transduction Laboratories, Lexington, KY), a rabbit anti-human protein arginine methyltransferase-1 (1:200; Millipore, Billerica, MA), a goat anti-rat dimethylarginine dimethylamonihydrolase-1 (1:500, overnight incubation; Santa Cruz Biotechnology Inc), a goat anti-rat dimethylarginine dimethylamonihydrolase-2 (1:100, overnight incubation; Santa Cruz Biotechnology Inc), a rabbit polyclonal anti-rat CSE (1:1,000, overnight incubation; Proteintech Group, Inc, Chicago, IL), a mouse monoclonal anti-rat CBS (1:1,000, overnight incubation; Abnova Corporation, Taipei, Taiwan), and a rabbit monoclonal anti-rat 3MST (1:500, overnight incubation; Novus Biologicals, Littleton, CO). The bands of interest were visualized with an enhanced chemiluminescence reagent (Perkin Elmer Life Sciences, Waltham, MA) and were quantified by densitometry (Quantity One Analysis software; Bio-Rad Laboratories, Hercules, CA). Band density was calculated as the integrated optical density minus the background value. The density of Ponceau S staining was used to correct for variations in total protein loading. Protein abundance was calculated as integrated optical density/Ponceau S staining.


NGS and analysis


Kidney samples (n=5–7/group) were pooled and used for NGS analysis (Welgene Biotech Co, Ltd, Taipei, Taiwan) as we described previously. Library construction was performed with the Solexa platform (Illumina Inc., San Diego, CA). The sequence was directly determined by sequencing-by-synthesis technology with the use of the TruSeq SBS Kit (Illumina). Raw sequences were obtained with the Illumina GA Pipeline software CASAVA (version 1.8; Illumina), which was expected to generate 30 million reads per sample. The TopHat program (Illumina Inc.) was used to align RNA-Seq reads to a rat reference genome to identify exon-exon splice junctions. Gene expression was quantified as reads per kilobase of exon per million mapped reads. The Cuffdiff tool from the cufflinks package was run to calculate expression changes and associated q values (probability values that are adjusted for false discovery rate) for each gene between control and L-NAME rats. Gene Ontology analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were performed with National Institutes of Health Database for Annotation, Visualization and Integrated Discovery Bioinformatics Resources (version 6.7) to identify candidate genes and pathways. For KEGG pathway analysis, the probability value was estimated for each gene and corrected for multiple testing by the Benjamini-Hochberg correction.


Quantitative real-time polymerase chain reaction


RNA was extracted as described previously. Several components of renin-angiotensin system (RAS) analyzed in this study included renin ( Ren ), angiotensinogen ( Agt ), angiotensin-converting enzyme-1 ( Ace ), Ace2 , angiotensin II type 1 receptor ( Agtr1a ), and angiotensin (1-7) receptor Mas1 . Six genes ( Cyp4a2, Hpgds, Ptgds, Ptgs1 [encodes for cyclooxygenase-1, COX-1], Ptgs2 [encodes for COX-2], and Ephx2 ) that belong to the arachidonic acid metabolism pathway were analyzed. We used 18S recombinant RNA (r18S) as a reference. Primers were designed with the use of GeneTool Software (BioTools, Edmonton, Alberta, Canada; Table 1 ). All samples were run in duplicate. To quantify the relative gene expression, the comparative threshold cycle (C T ) method was used. For each sample, the average C T value was subtracted from the corresponding average r18S value, which calculated the ΔC T . ΔΔC T was calculated by subtracting the average control ΔC T value from the average experimental ΔC T . The fold-increase of the experimental sample relative to the control was calculated with the use of the formula 2 -ΔΔCT .



Table 1

Polymerase chain reaction primers sequences




























































Gene Forward Reverse
Ren 5 aacattaccagggcaactttcact 3 5 acccccttcatggtgatctg 3
Agt 5 gcccaggtcgcgatgat 3 5 tgtacaagatgctgagtgaggcaa 3
Ace 5 caccggcaaggtctgctt 3 5 cttggcatagtttcgtgaggaa 3
Ace2 5 acccttcttacatcagccctactg 3 5 tgtccaaaacctaccccacatat 3
Agtr1a 5 gctgggcaacgagtttgtct 3 5 cagtccttcagctggatcttca 3
Mas1 5 catctctcctctcggctttgtg 3 5 cctcatccggaagcaaagg 3
Cyp4a2 5 agagcttcagaaggccaggaa 3 5 caggtcctcatctgacaagctctt 3
Hpgds 5 gatcctaaagaggccacagacaa 3 5 gtggcgagaagtttgcaaatg 3
Ptgds 5 ttcaagagtaaacacaggtgagagaag 3 5 cagggcttgggtctcaagag 3
Ptgs1 5 gagtccttctccaacgtgagcta 3 5 ctggtaactgcttcttccctttg 3
Ptgs2 5 cccacagtcaaagacactcaggta 3 5 ccggcaccagaccaaaga 3
Ephx2 5 cacagcctcggctttgaga 3 5 tcacatacccatggctgacatc 3
R18S 5 gccgcggtaattccagctcca 3 5 cccgcccgctcccaagatc 3

Only gold members can continue reading. Log In or Register to continue

Stay updated, free articles. Join our Telegram channel

May 2, 2017 | Posted by in GYNECOLOGY | Comments Off on Maternal melatonin or N-acetylcysteine therapy regulates hydrogen sulfide-generating pathway and renal transcriptome to prevent prenatal N G-Nitro-L-arginine-methyl ester (L-NAME)-induced fetal programming of hypertension in adult male offspring

Full access? Get Clinical Tree

Get Clinical Tree app for offline access