Objective
The objective of the study was to investigate interleukin-6 receptor (IL6R) isoforms and sheddases in the ovarian tumor microenvironment.
Study Design
Expression of IL6R and sheddases was measured in tissue samples of papillary serous ovarian carcinomas and benign ovaries by real-time polymerase chain reaction and immunohistochemistry. Murine xenograft samples were tested by enzyme-linked immunosorbent assay to discriminate and evaluate tumor and host contributions of IL6R.
Results
IL6R expression was increased in malignant ovarian tumors and localized to epithelial cells. Expression of a soluble splice variant of IL6R was increased in malignant tumors, as were the sheddases for the full-length isoform. An in vivo xenograft model showed that host IL6R expression is also increased and regulated by tumor-associated inflammation.
Conclusion
IL6R is overexpressed in epithelial ovarian malignancies because of increases in a soluble IL6R variant, in the sheddases for full-length IL6R and host IL6R expression. Soluble IL6R may be an efficacious target for reducing IL6-mediated ovarian tumor progression.
Ovarian cancer is the most deadly of the gynecological malignancies. Most gynecologic oncologists initially treat the disease with debulking surgery, followed by adjuvant chemotherapy with platinum and taxane agents. After an initial response to chemotherapy, the cancer will recur in the majority of patients but with chemoresistant properties. The efficacy of second-line and salvage therapies for patients who fail initial surgical and medical therapy is limited at best. A greater understanding of the mechanisms by which ovarian cancers metastasize and develop chemoresistance is essential for reducing the high mortality associated with these malignancies.
Interleukin-6 (IL-6) is an important proinflammatory cytokine that is frequently up-regulated in acute and chronic inflammatory conditions, including many cancers (reviewed elsewhere ). IL-6 signaling occurs through a hexameric complex of IL-6, a specific α receptor (IL6R; glycoprotein [gp]80), and a shared β-signaling receptor (gp130). Dimerization of gp130 leads to activation of Janus tyrosine kinases and subsequent translocation of signal transducer and activator of transcription (Stat) transcription factors. Stat3 is the major Stat induced by IL-6 signaling, and its nuclear translocation induces a transcriptional program resulting in inflammation, cell survival, or differentiation, depending on the cellular context. In addition to membrane-bound IL6R, several soluble isoforms also exist.
Expression of both membrane-bound and soluble forms of IL6R are largely restricted to hepatocytes and immune cells, and therefore, signaling through membrane-bound IL6R is restricted to these cells. However, the soluble isoforms of IL6R are excreted from these cells types and unexpectedly function as agonists for IL6R signaling and hence allow IL6R-mediated signaling in cells that do not express IL6R. This occurs through initial binding of IL-6 to soluble extracellular IL6R and subsequent binding of this complex to the membrane-bound signaling receptor, gp130.
This binding results in dimerization of gp130, which, in turn, leads to stat3 activation that occurs in a similar fashion to that induced by membrane-bound IL6R. Because gp130 is ubiquitously expressed, the potential to respond to IL-6 is conferred on all cells in the presence of soluble IL6R. This process, known as trans-signaling, has been found to be important in multiple disease states including rheumatoid arthritis, asthma, inflammatory bowel disease, and colon cancer. It has been shown that many of the inflammatory functions of IL-6 signaling can be prevented by inhibiting the soluble isoform of IL6R with a soluble form of gp130. Therefore, the soluble isoform plays important roles in inflammatory contexts by allowing a heightened response to IL-6 in all cell types at the site of inflammatory challenge.
Soluble IL6R can be generated by 2 distinct processes: differential splicing and proteolytic cleavage. The differentially spliced isoform lacks a transmembrane domain and is secreted as a soluble, functional receptor. The proteolytic enzymes responsible for cleavage of full-length IL6R are a disintegrin and metalloprotease domain (ADAM)-17, also known as tumor necrosis factor alpha–converting enzyme and to a lesser extent, ADAM10. These sheddases cleave full-length IL6R in a membrane proximal site to release a soluble, functional receptor. A study of IL-6 signaling in an angiotensin-induced cardiac model suggested that the 2 forms of soluble IL6R may have different functions leading to either hypertrophy or hypertension.
It is well established that IL-6 is up-regulated in both the serum and ascites of ovarian cancer patients and is associated with disease progression. IL-6 has also been implicated in chemotherapeutic resistance in ovarian cancer cell lines and in patients with ovarian cancer. However, the status of IL6R expression in ovarian cancer has not been adequately addressed to date. One study reports increased expression of soluble IL6R in the sera of patients in the early stages of various tumor types, but specific data for ovarian cancer were not available. Despite the importance of the soluble isoforms of IL6R in inflammation, there has not been a characterization of these isoforms in ovarian cancer.
Given that we have previously shown that inflammation drives the spread of ovarian tumors in murine models, a thorough evaluation of inflammatory IL6R isoforms in the tumor microenvironment is needed. Here we describe the increased expression of IL-6, total IL6R, differentially spliced IL6R, ADAM10, and ADAM17 in ovarian tumors. Furthermore, we show that both tumor and host cells contribute to soluble IL6R expression in the tumor environment.
Materials and Methods
Patient tissue collection and cell lines
Tissue samples from malignant and nonmalignant ovaries were collected from patients undergoing routine gynecologic procedures at the University Hospital and the Christ Hospital in Cincinnati, OH ( Table 1 ). Normal ovarian tissue was collected from patients 1-16. Malignant tissue collected from patients 17-27 were from primary ovarian epithelial carcinomas. Tissues were immediately snap frozen in liquid nitrogen at the time of surgery and stored at −80°C until analysis. Human ES-2 and SKOV3, clear cell and serous papillary ovarian carcinoma cell lines, respectively, were obtained from American Type Culture Collection (Manassas, VA). Cells were maintained in Dulbecco’s Modified Eagles media with 10% fetal calf serum and tested negative for mycoplasma contamination.
| Patient no. | Age | Pathology | Stage |
|---|---|---|---|
| 1-16 | 39-71 | Normal ovarian tissue | |
| 17 | 69 | Mixed papillary serous and undifferentiated tumor | IV |
| 18 | 56 | Papillary serous | II |
| 19 | 62 | Papillary serous | IIIC |
| 20 | 47 | Papillary serous | IIIC |
| 21 | 75 | Papillary serous | IIIC |
| 22 | 50 | Papillary serous | IV |
| 23 | 39 | Papillary serous, high grade | IIIC |
| 24 | 36 | Papillary serous cystadenocarcinoma | IB |
| 25 | 68 | Papillary serous | III |
| 26 | 77 | Papillary serous | IV |
| 27 | 55 | Papillary serous | III |
Animal studies
Human tumor cell lines (ES-2 and SKOV3) were harvested, resuspended in Matrigel (basement membrane protein gel, BD Biosciences, Franklin Lakes, NJ), and implanted in the ovaries of severe combined immunodeficiency (SCID) mice (Charles River Laboratories, Wilmington, MA), as previously described. Groups of mice (n = 6) were administered acetyl salicylic acid (ASA; 100 mg/kg; Sigma, St Louis, MO), phosphate-buffered saline, or thioglycolate (0.5 mL of a 3% solution; Fluka, Buchs, Switzerland) by twice-weekly intraperitoneal injection. Additional mice without tumors were administered ASA, saline, or thioglycolate. Peritoneal lavage with phosphate-buffered saline was performed on anesthetized mice. Lavage fluid was centrifuged and stored at −80°C until analysis. Guidelines for the care and use of laboratory animals approved by the University of Cincinnati Institutional Animal Care and Use Committee were followed.
RNA isolation and reverse transcription–polymerase chain reaction (RT-PCR)
Ribonucleic acid (RNA) was extracted from patient tissue samples with the RNeasy lipid kit (Qiagen, Valencia, CA) and quantified with a spectrophotometer (Nanodrop, Wilmington, DE). Reverse transcription was performed with the Thermoscript II kit (Invitrogen, Carlsbad, CA). Real-time polymerase chain reaction (PCR) was performed with primers specific for IL-6, both isoforms of IL6R (total IL6R), full-length IL6R (variant 1), differentially spliced IL6R (variant 2), ADAM10, and ADAM17 ( Table 2 ) with a Realplex Mastercycler (Eppendorf, Netheler, Germany). Primer specificity was confirmed by checking product sizes on an agarose gel and performing a melt-curve analysis on each run. Gene expression was normalized against the human L32 housekeeping gene, as previously described.
| Gene | 5′ | 3′ |
|---|---|---|
| IL-6 | CTCACCTCTTCAGAACGAATTGACAAACAAA | GGTACTCTAGGTATACCTCAAACTCCAAAA |
| IL6R | GCTGTGCTCTTGGTGAGGAAGTTT | CTGAGCTCAAACCGTAGTCTGTAGAAA |
| IL6R variant 1 (full-length) | GCCTCCCAGTGCAAGATTCTTCTT | CCGCAGCTTCCACGTCTTCTT |
| IL6R variant 2 (differentially spliced) | GCGACAAGCCTCCCAGGTT | CCGCAGCTTCCACGTCTTCTT |
| ADAM10 | AATGGATTGTGGCTCATTGGTGGG | TGGAAGTGGTTTAGGAGGAGGCAA |
| ADAM17 | CTTATGTTGGCTCTCCCAGAGCAAA | CATCCGGATCATGTTCTGCTCCAAAA |
Immunohistochemistry
Immunohistochemistry was performed on paraffin-embedded samples of both benign and malignant ovarian tissue to detect IL6R. Briefly, samples were deparaffinized, and antigen retrieval was performed in citrate buffer (10 mM with 0.05% Tween 20, pH 6.0) for 10 minutes at 95°C. Slides were incubated overnight with rabbit antihuman IL6R (sc-661; detects both isoforms) at a dilution of 1:400 at 4°C, followed by biotinylated goat antirabbit immunoglobulin G (1:200). ABC Elite kit (Vector, Burlingame, CA) and 3,3 diaminobenzidine substrate (Sigma) were used in the detection, followed by hematoxylin counterstain.
IL6R ELISA
Peritoneal lavage fluid from mice was analyzed by enzyme-linked immunosorbent assay (ELISA) (R&D Systems, Minneapolis, MN), according to the manufacturer’s instructions, to assess expression of human and murine soluble IL6R. Cross-reactivity between human and mouse IL6R is negligible with the use of these species-specific IL6R ELISA kits. The enzymatic reactions were detected at 570 nm and subtracted from background at 450 nm with a spectrophotometric plate reader.
Statistical methods
Data are represented as mean ± SEM were analyzed by the Mann-Whitney U test.
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
