Objective
Clinical evidence suggests that magnesium sulfate may reduce the risk of fetal neurologic injury in preterm delivery. Matrix metalloproteinase-9 (MMP-9) levels are elevated in preterm labor patients. There is evidence that MMP-9 may break down the blood-brain barrier in humans, causing cytokine mediated cell injury. Our objective was to determine whether the addition of magnesium sulfate attenuates activity of MMP-9, a complex zinc-dependent enzyme, in fetal cord plasma.
Study Design
We collected cord plasma in 6 term, unlabored patients. Using enzyme-linked immunosorbent assay, we measured the activity of MMP-9 with varying concentrations of magnesium sulfate added in vitro. Results were verified using a human umbilical cord vein endothelial cell (HUVEC) line.
Results
Addition of physiologic doses of magnesium sulfate (0.07 mg/mL) resulted in a 25% decrease in active MMP-9 ( P = .03). In a HUVEC line, magnesium sulfate resulted in a 32% decrease in MMP-9 activity ( P = .00012).
Conclusion
The addition of magnesium sulfate attenuated MMP-9 activity in cord plasma and in a HUVEC line.
Multiple studies have demonstrated that antenatal administration of magnesium sulfate (MgSO 4 ) to patients with threatened preterm delivery (PTD) is associated with a reduction in the incidence of cerebral palsy (CP) without a concomitant increase in neonatal mortality. The recent Maternal Fetal Medicine Network randomized controlled trial for the prevention of cerebral palsy by Rouse et al is the largest and most comprehensive of these studies. A proposed theory of how MgSO 4 exerts its neuroprotective effect is by antagonizing N-methyl D-aspartate (NMDA) regulated receptor activity, resulting in reduced vascular instability, less hypoxic damage, and/or suppression of cytokine/excitatory amnio acid effects.
For Editors’ Commentary, see Table of Contents
Magnesium may also contriubute to neuroprotection by inhibiting degradation of the blood-brain barrier. A biologically plausible target for the effects of magnesium is matrix metalloproteinases (MMPs), a large subfamily of zinc-dependent enzymes implicated in hydrolysis of extracellular matrix proteins. MMP-9 is thought to contribute to brain damage in adults with sepsis by breaking down the blood-brain barrier and allowing transmigration of inflammatory cytokines. MMPs are secreted into the extracellular space by various cell types, including macrophages, microglial cells, astrocytes, and activated T lymphocytes. They are secreted as inactive zymogens and activated by cleavage. Tissue inhibitors of the MMP family (TIMPs) regulate proteolytically cleaved MMP activity by binding to and inactivating the enzyme.
There is evidence that MMPs are associated with neurologic injury in fetuses. Amniotic fluid levels of MMPs correlate with subsequent development of cerebral palsy in children at the age of 3 years. Romero et al determined that patients with preterm labor and preterm rupture of membranes had elevated fetal plasma levels of MMP-9, independent of infection or other cytokines. To our knowledge, MMP-9 activity levels in umbilical cord serum or plasma have not been studied with respect to maternal MgSO 4 administration. It is biologically plausible that the fetal neuroprotective effect found in antepartum MgSO 4 therapy results from a competitive inhibition of zinc dependent MMP-9 enzyme activity. Thus, attenuation of MMP-9 activity may inhibit degradation of the blood-brain barrier, thereby protecting the fetal brain from invasion of inflammatory cytokines. In this report, we tested the hypothesis that MgSO 4 decreases activated MMP-9 activity in vitro.
Materials and Methods
This study was approved by the institutional review board at Madigan Army Medical Center. To determine whether MgSO 4 was sufficient to inhibit active MMP-9 endogenously present in cord blood in the absence of physiologic inducers of MMP-9 activity (ie, preterm labor and/or infection), cord blood from unlabored patients undergoing elective cesarean sections was pretreated with MgSO 4 . We chose to assay fetal plasma instead of serum because white blood cells release their cytoplasmic granules of MMP-9 in serum as a consequence of the clotting process, resulting in artificially elevated levels compared with the in vivo state.
We collected cord plasma at time of delivery in 6 term patients between 37 and 41 weeks’ gestation. No patients were in labor, and all were carrying singleton fetuses and undergoing scheduled cesarean section. Patients with underlying renal, autoimmune, or vascular diseases, and patients with gestational or pregestational diabetes were excluded from study participation. Likewise, patients who reported tobacco or illicit drug use, alcohol ingestion, or vitamins other than standard prenatal vitamins were not enrolled. All patients were normotensive through their antepartum course.
Umbilical cord samples were obtained immediately after cord clamping by venipuncture of the umbilical vein and collected in heparinized specimen tubes free of ethylenediamine tetraacetic acid (EDTA). The specimens were centrifuged at 1500× g for 15 minutes to extract plasma. Fetal plasma was stored at −20°C until analysis.
After fetal plasma samples were collected, they were pretreated with either phosphate-buffered saline (vehicle control) or MgSO 4 at levels comparable with those found in the fetal cord serum of patients receiving magnesium therapy for treatment of preterm labor (0.07 mg/mL). Supraphysiologic concentrations were also tested (0.7-7 mg/mL). Both total and active MMP-9 enzyme levels were measured using a modified enzyme-linked immunosorbant assay (ELISA) procedure (Amersham MMP-9 Biotrak Activity Assay; GE Healthcare Buckinghamshire, UK). Briefly, antibody-captured MMP-9 proteolytically cleaves the precursor form of a modified murokinase detection enzyme to its active form. MMP-9 enzyme activity was quantified by addition of a chromogenic peptide substrate. Optical density at 405 nm wavelength was measured using a microplate spectrophotometer (Synergy HT; Biotek Instruments,Winooski, VT). Total MMP-9 levels were measured in parallel experiments by adding excess of the MMP-9 substrate p-aminophenylmercuric acetate (APMA) and quantifying enzyme activity.
Human umbilical cord vein endothelial cells (HUVECs) were purchased from American Type Culture Collection (CRL-1730; Manassas, VA), and grown according to manufacturer specifications. Cells were grown to approximately 75-80% confluence treated with the phorbol ester PMA (phorbol 12-myristate 13-acetate; Fisher Scientific, Pittsburgh, PA) overnight to induce MMP-9 production and secretion as described. Media was exchanged and cells were cultured in supplier-recommended growth media for 2 days. Cells were pretreated for 1 hour in either phosphate-buffered saline vehicle or increasing doses of MgSO 4 (0.07-7 mg/mL). Supernatants were assayed for active MMP-9 by ELISA. Peripheral blood mononuclear cells were isolated from cord plasma by histopaque 1077 gradient as described.
We used relatitive quantitative polymerase chain reaction (Rel q PCR) to examine changes in MMP-9 transcription. Cells were scraped from the plate and then aliquoted into microcentrifuge tubes and snap frozen in liquid nitrogen then stored at −70°C. RNA was isolated according to the manufacturer’s instructions (Qiagen RNeasy Mini Kit, catalog no. 74104; Qiagen, Chatsworth, CA). A probe was designed from Roche Universal Probe Library probe 27 (Roche Diagnostics, Indianapolis, IN), which is specific for the MMP-9 gene, Uniprot/SWISSPROT: ACC: P14780 . Probe specific MMP-9 primers were ordered from Invitrogen (5′ to 3′ Forward, TCTTCCCTGGAGACCTGAGA, 5′ to 3′ Reverse, GAGTGTAACCATAGCGGTACAGG) and used for PCR reactions. In accordance with Roche LightCycler 480 RNA Master Hydrolysis Probe Kit (catalog no. 04991885001; Roche Diagnostics), 50-100 ng RNA per 20 μL reaction was used. The level of our gene of interest, MMP-9, was compared with the reference housekeeping gene, phosphoglycerate kinase 1 (PGK-1). Calculations for MMP-9 target gene expression in relation to PGK-1 were based on measuring crossing points according to established mathematical algorithms.
Statistical analyses were performed using a paired t test, with α = .05 determined a priori designated as defining biologically significant differences among treatment groups.
Results
Total MMP-9 levels varied among patients (178 ± 49 ng/mL). Levels of endogenously active MMP-9 in fetal cord blood were consistently a fraction of the total MMP-9 (6.8 ± 2 ng/mL), presumably because of association with TIMP inhibitors. The addition of physiologic doses of MgSO 4 (0.07 mg/mL) resulted in a 25% decrease in active MMP-9 ( P = .03) in cord blood specimens (n = 6) ( Figure 1 , A). A comparable percent decrease was observed with 0.7 mg/mL MgSO 4 ( P = .03), but 100 times physiologic levels did not alter MMP-9 activity ( Figure 1 , A). Because MMP-9 targets endothelial cell degradation, we tested whether MgSO 4 treatment was sufficient to attenuate MMP-9 activity in an in vitro model. HUVECs were pretreated with the phorbol ester PMA to induce MMP-9 transcription and secretion. Physiologically relevant doses of MgSO 4 (0.07 mg/mL) resulted in a 32% decrease in MMP-9 activity ( P = .00012) ( Figure 1 , B). Comparable results were seen after pretreatment with 0.7 mg/mL MgSO 4 ( Figure 1 , B). Comparable to fetal cord plasma, however, in vitro treatment of HUVEC with 100-fold physiologic doses (7 mg/mL) were ineffective at attenuating MMP-9 activity ( Figure 1 , B).
