Participant selection

A convenience sample of women with preeclampsia and women with uncomplicated, normotensive pregnancies (pregnant controls) matched by gestational age at the time of enrollment were recruited from the labor and delivery units, antenatal testing units, and prenatal clinics at the University of Utah Health Sciences Center and Intermountain Medical Center in Salt Lake City, UT. Nonpregnant women aged 18-45 years with previous normal pregnancies comprised an additional control group.

Women were included in the preeclampsia group if they had a singleton fetus at a gestation of 24 weeks or longer and met criteria for diagnosis of preeclampsia as defined by the American Congress of Obstetrics and Gynecology. Women with preeclampsia were excluded if they had any of the following conditions: multiple gestation, active labor, current or recent infection, any known platelet or coagulation disorder, heparin or aspirin use, tobacco use, current substance abuse, diabetes, renal disease, or autoimmune disease. Pregnant controls were matched 1:1 to women with preeclampsia and met the same exclusion criteria. In addition, pregnant controls were excluded if they had hypertension, a history of preeclampsia in a previous pregnancy, or fetal growth restriction.

Nonpregnant women were included if they were aged 18-45 years, with no chronic medical conditions, no known disorder of platelets or coagulation, and no current tobacco use. Experiments performed to characterize sFlt-1 expression and release from PMA utilized cells from women meeting the same criteria as nonpregnant controls. All participants gave written informed consent. Protocols for participant enrollment, venipuncture, and other study procedures were approved by the institutional review board (IRB) at each institution (IRB number 1009177, Intermountain Healthcare, and IRB number 29586, University of Utah).

Whole blood and plasma studies

Whole blood was obtained from each participant through standard venipuncture and collected into syringes containing acid citrate dextrose. Whole blood flow cytometry was used to determine the relative ratio of circulating PMA and surface expression of P-selectin on platelets at baseline. To assess circulating PMAs, 50 μL of whole blood was added to 20 μL of fluorescein isothiocyanate-labeled anti-CD14 and 20 μL of either phycoerythrin-labeled anti-CD41 or IgG isotype control (BD Biosciences, San Jose, CA). After incubation at 37°C for 15 minutes, the cells were fixed with fatty acyl-CoA synthase (FACS) lysis buffer (BD BioSciences) for 10 minutes at room temperature and stored at 4°C until analysis within 24 hours.

P-selectin surface expression was evaluated by diluting whole blood 1:10 using 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid-Tyrode’s buffer. Ten microliters of diluted blood were then incubated with 10 μL of phycoerythrin-labeled anti-CD41 and 10 μL of either fluorescein isothiocyanate-labeled anti-P-selectin or IgG isotype control (BD BioSciences) for 15 minutes at 37°C. Cells were fixed with FACS lysis buffer for 10 minutes at room temperature, and then stored at 4°C until being read within 24 hours. All flow cytometry analyses were performed using a BD FACScan flow cytometer. Platelet-poor plasma from the remaining whole blood was obtained by centrifuging whole blood initially at 150 × g to remove the red blood cells (RBCs)/white blood cells (WBCs). Platelet-rich plasma (PRP) was removed and centrifuged at 300 × g to remove platelets. Platelet-poor plasma was stored at –80 C until analysis for sFlt-1, which was performed using a commercially available enzyme-linked immunosorbent assay (ELISA; R&D Systems, Minneapolis, MN).

Purified platelet and monocyte studies

Platelets were isolated as described above. Contaminating leukocytes were removed from platelet preparations by CD45-positive selection (Miltenyi Biotec, Bergisch Gladbach, Germany), and purified platelets were resuspended in M199 culture medium (BioWhitaker, Walkersville, MD).

Monocytes were isolated from whole blood, which was centrifuged at 150 × g for 20 minutes to separate the PRP from the RBCs/WBCs. The PRP was removed and the remaining RBC/WBC mixture was resuspended with 0.9% sterile saline back to the original volume and layered over an equal volume of Ficoll-Paque Plus (GE Healthcare Biosciences, Piscataway, NJ). The layered cells were then centrifuged for 30 minutes at 250 × g at 20°C. After 30 minutes, the mononuclear leukocyte layer was removed and washed with Hanks’ balanced salt solution (Sigma-Aldrich, St Louis, MO) with 1% human serum albumin (HBSS/A) (University of Utah Hospital, Salt Lake City, UT) and centrifuged for 10 minutes at 300 × g at 20°C. The cell pellet was then resuspended in 400 μl of HBSS/A and 100 μL of CD14 microbeads (Miltenyi Biotec) and incubated at 4°C for 15 minutes. Cells were washed with HBSS/A to remove any free CD14 microbeads, resuspended in 500 μL of HBSS/A, and monocytes were isolated using an autoMACs cell separator (Miltenyi Biotec). Cells were then washed with HBSS/A, resuspended in M199 (BioWhitaker), and counted.

Freshly isolated platelets and monocytes were mixed together at a ratio of 100:1. This ratio approximates ratios of platelets to monocytes in whole blood. Preliminary studies found this ratio induces marked release of sFlt-1 from PMAs compared with substantially lower or higher ratios of platelets to monocytes (data not shown). Thrombin activation was used to stimulate PMA formation, at a dose of 0.1 U/mL (Sigma-Aldrich). Thrombin-stimulated monocytes alone and lipopolysaccharide (LPS)-stimulated monocytes were used in control experiments.

Cells were incubated at 37°C and then centrifuged at 13,000 × g for 2 minutes to obtain cell culture supernatants. Cells were collected and lysed after 2 hours of incubation for ribonucleic acid (RNA) experiments and after 18 hours of incubation for all other experiments. Cell culture supernatants were collected and frozen at –80°C until further analysis. Cells were lysed in Trizol (Invitrogen, Grand Island, NY) for messenger RNA (mRNA) extraction or in cell lysis buffer for ELISA (R&D Systems). sFlt-1 and IL-8 in cell culture supernatants and total Flt-1 in cell lysates were determined by ELISA (R&D Systems). Platelets, monocytes, and existing PMAs present in the monolayer obtained after centrifugation over Ficoll were fixed in 2% paraformaldehyde and stained using fluorescent wheat germ agglutinin (WGA) (Invitrogen) with and without AlexaFluor 488-conjugated antibody to Flt-1 (Santa Cruz Biotechnology, Santa Cruz, CA), sFlt-1 (Invitrogen), or IgG control (Santa Cruz Biotechnology). Cells were imaged using confocal microscopy.

mRNA studies

RNA was isolated with Trizol reagent following the manufacturer’s instructions. Isolated RNA was deoxyribonuclease treated with Ambion DNA-free (Life Technologies, Grand Island, NY). Complementary deoxyribonucleic acid was synthesized using oligodeoxythymidine primers (Invitrogen). Real-time polymerase chain reaction was used to determine the level of sFlt-1 expression using primers specific for the portion of intron 14 that is specific for sFlt-1. The sequence for the forward primer is as follows: TGAGCACTGCAACAAAAAGG; the reverse primer sequence is AGAGGTTGGCATCAAAATGG. The results were normalized to glyceraldehyde-3-phosphate dehydrogenase and compared with baseline expression using the ΔΔ cycle threshold method.

Inhibition of sFlt-1 release from PMA

Freshly isolated platelets and monocytes were preincubated for 30 minutes with 5 μg/mL actinomycin-D or 5 μg/mL cycloheximide (Sigma-Aldrich) to inhibit RNA transcription and translation, respectively, before the addition of thrombin. Specific pathway inhibitors were also added to thrombin-stimulated platelets and monocytes: U0126 (EMD Millipore, Billerica, MA), SB203580 (EMD Millipore), Bay-11-7082 (Sigma-Aldrich), and SP600125 (Sigma-Aldrich). To inhibit binding between P-selectin on the surface of activated platelets and P-selectin glycoprotein ligand-1 (PSGL-1) on the monocyte surface, an anti-P-selectin antibody 20 μg/mL or IgG isotype control (R&D Systems) was added to monocytes before the addition of platelets and thrombin.

Statistical analysis

Experiments examining the release of sFlt-1 from PMAs were compared with appropriate controls using an independent-samples Student t test. The results presented represent the mean ± SEM for 3-5 experiments.

For participants in the case-control study, paired Student t tests were used to compare categorical variables, and a χ ² test was used for the dichotomous variables between the women with preeclampsia and the pregnant controls. An independent Student t test and a χ ² test were used for a comparison of continuous and dichotomous variables, respectively, between nonpregnant controls and both pregnant groups. A value of P < .05 was considered significant for all tests.