Objective
The objective of this study was to determine the effect of probiotic Lactobacillus rhamnosus GR-1 supernatant (GR-1 SN) on lipopolysaccharide-induced preterm birth (PTB) and outputs of cytokines, chemokines, and progesterone in pregnant CD-1 mice.
Study Design
We compared PTB rates after intrauterine injection of lipopolysaccharide with and without previous GR-1 SN treatment. Cytokines and chemokines in the maternal plasma, myometrium, placenta, and amniotic fluid were examined with multiplex assay, and circulating maternal progesterone was measured with enzyme-linked immunoassay. Statistical significance was assessed with 2-tailed 1-way analysis of variance or analysis of variance on ranks. Fetal sex ratios in mice that delivered preterm were compared with those that delivered at term after lipopolysaccharide and GR-1 SN treatments.
Results
GR-1 SN reduced lipopolysaccharide-induced PTB by 43%. GR-1 SN significantly decreased the lipopolysaccharide-induced production of interleukin (IL)-1β, -6, and -12p40, tumor necrosis factor–α, CCL4, and CCL5 in maternal plasma; IL-6, -12p70, -17, and -13 and tumor necrosis factor–α in myometrium; IL-6, -12p70, and -17 in placenta; and IL-6, tumor necrosis factor–α, CCL3, and CCL4 in amniotic fluid. Maternal plasma progesterone was reduced significantly after lipopolysaccharide injection with and without GR-1 SN pretreatment. There was no difference in fetal sex ratios between mice that delivered preterm and those that did not after lipopolysaccharide and GR-1 SN treatments.
Conclusion
The supernatant of probiotic L rhamnosus GR-1 attenuated lipopolysaccharide-induced inflammation and PTB in vivo. GR-1 SN may confer therapeutic benefits in the prevention of infection-associated PTB by controlling systemic and intrauterine inflammation.
Preterm birth (PTB) occurs in 11.1% of all pregnancies worldwide; premature infants are at a higher risk of experiencing adverse long-term health outcomes. Inflammation is a contributing factor to both infection-mediated PTB and spontaneous PTB; the most common route of infection is thought to be ascending through the vagina. In this study, we administered lipopolysaccharide to pregnant CD-1 mice as a model for both infection and inflammation-associated PTB because lipopolysaccharide activates Toll-like receptor 4–mediated inflammatory pathways. Antibiotic administration to prevent PTB has been unsuccessful, possibly because antibiotics do not replenish vaginal lactobacilli. In addition, their prolonged use promotes resistant bacterial strains.
Probiotics, defined as “live microorganisms that, when administered in adequate amounts, confer a health benefit on the host,” have been used to treat inflammatory conditions in the gastrointestinal and genitourinary tracts. Probiotic lactobacilli, a genus commensal to human vagina and intestinal tracts, reduce the recurrence of bacterial vaginosis in nonpregnant women and are associated with a 40% increase in the risk of PTB. Lactobacilli can modulate immune responses, reduce pathogenic adherence, and/or produce bacteriocins to discourage pathogen growth. Our previous studies have also demonstrated that Lactobacillus rhamnosus GR-1 and its supernatant have antiinflammatory properties.
Cytokines play a pivotal role in PTB in both humans and animals, and the predominance of anti- over proinflammatory cytokines is important to pregnancy maintenance. Cytokines can act as regulators of the innate and adaptive immune systems and hematopoiesis. Intrauterine tissues and circulating leukocytes are potential sources of cytokines. Chemokines is thought to involve the ability to attract decidual leukocytes that lead to the recruitment of additional proinflammatory cytokines that amplify the inflammatory cascade.
The effect of lactobacilli on PTB and inflammatory responses in pregnant CD-1 mice in vivo is unknown. In this study, we test the hypothesis that GR-1 supernatant will attenuate lipopolysaccharide-induced PTB and also profile systemic and intrauterine immune markers in lipopolysaccharide-treated mice with and without GR-1 supernatant treatment. Finally, we examine whether the effect of GR-1 supernatant on lipopolysaccharide-induced PTB is dependent on changes in maternal plasma progesterone or sex of the fetus.
Materials and Methods
Animals
Female HSD:ICR (CD-1) outbred mice (8-12 weeks old; Harlan Laboratories, Toronto, Ontario) were bred; the morning of vaginal plug detection was designated gestational day 1 (gestational length, 19-20 days). Animals were handled in accordance with guidelines of the Canadian Council for Animal Care, and all procedures were approved by the Animal Care Committee of Toronto Center for Phenogenomics (Animal Use Protocol #0164). Animals were housed in a pathogen-free, humidity-controlled 12-hour light:12-hour dark cycle animal facility with free access to food and water.
L rhamnosus GR-1 supernatant preparation
GR-1 was grown for 8-10 hours anaerobically at 37°C in de Man, Rogosa, and Sharpe broth (BD, Mississauga, Ontario, Canada) to an optical density of approximately 0.9 at 600 nm (which represented approximately 10 8 –10 9 colony-forming units/mL of bacteria) and centrifuged at 3000 rpm for 10 minutes at 25°C. The supernatant (GR-1 supernatant) was filtered twice with 0.22-μm filters to remove residual bacteria. We used 200 μL of GR-1 supernatant, which represented approximately 2 × 10 7 –10 8 colony-forming units/mL of bacteria for intraperitoneal injection because, in previous studies, intraperitoneal injection of approximately 10 7 colony-forming units of GR-1 increased antiinflammatory cytokine G–colony-stimulating factor (CSF) production in mice.
Intrauterine injection of lipopolysaccharide by minilaparotomy
Intrauterine injection of lipopolysaccharide was given by minilaparotomy on gestational day 15, as previously described. Isoflurane anesthetized mice were given analgesic buprenorphine (0.1 mg/kg), and an incision (approximately 1 cm) was made to expose the lower segments of the uterine horns. Saline solution (100 μL) or lipopolysaccharide ( Escherichia coli 055:B5; Sigma-Aldrich, St. Louis, MO) dissolved in 100-μL saline solution was injected between the 2 lowest gestational sacs of either the left or right uterine horn. Fascia and skin were closed with 4.0 Vicryl sutures and staples, respectively. Mice were housed in individual cages.
Dose effect of lipopolysaccharide on PTB rate (group 1)
A dose response for lipopolysaccharide was established with saline solution and 25μg, 65 μg, 125 μg, or 250 μg of lipopolysaccharide (n = 10 per group) to determine the lowest dose that produced 100% PTB. PTB was defined as the delivery of at least 1 pup within 48 hours of lipopolysaccharide injection. Lipopolysaccharide 125 μg was the lowest dose that resulted in 100% PTB and was chosen for subsequent experiments.
Effect of GR-1 supernatant on the timing of lipopolysaccharide-induced PTB (group 2)
The mice were assigned randomly to receive saline solution, GR-1 supernatant, lipopolysaccharide 125μg, or lipopolysaccharide 125μg + GR-1 supernatant (n = 9-17 per group). Animals were given 2 doses of 200 μL of GR-1 supernatant or saline solution intraperitoneally at 24 hours (gestational day 14) and 15-30 minutes (gestational day 15) before intrauterine lipopolysaccharide or saline solution injection. In our preliminary experiments, we observed no effect of orally administered GR-1 supernatant on PTB, and we chose not to administer GR-1 vaginally because of concerns for possible vaginal leakage. Given our previous experiments whereby intraperitoneal injection of GR-1 supernatant caused immune responses in nonpregnant mice and in vitro, we chose to give GR-1 supernatant intraperitoneally in these studies. Animals were monitored hourly until term for the delivery of pups, and the time of delivery was recorded.
Effect of GR-1 supernatant on cytokines and chemokines (group 3)
The mice were assigned randomly to receive saline solution, GR-1 supernatant, lipopolysaccharide 125 μg, or lipopolysaccharide 125 μg + GR-1 supernatant (n = 10 per group). Most of the animals in group 2 delivered from 10-15 hours after lipopolysaccharide administration; therefore, the animals in group 3 were killed with carbon dioxide 8 hours after lipopolysaccharide or saline solution injection for the collection of amniotic fluid and placental and myometrial tissues. Before death, maternal blood was collected from anesthetized mice by cardiac puncture, and plasma was obtained by centrifugation at 5000 g for 15 minutes at 4°C. Amniotic fluid was pooled from all gestational sacs and centrifuged to remove any cellular debris. Placental tissue was separated from decidua and fetal membranes in ice-cold phosphate-buffered saline solution and pooled from all fetuses. Myometrium was separated from decidua and endometrium by scraping. All samples were flash-frozen in liquid nitrogen and stored at –80°C. In a subgroup of animals (n = 5), we measured progesterone concentrations in maternal plasma.
Fetal sex ratios (group 4)
The mice received lipopolysaccharide 125 μg + GR-1 supernatant (n = 16) and were monitored for PTB. After delivery of at least 1 pup, the animals were killed, and individual fetal tails were collected and genotyped to determine fetal sex. For animals that delivered at term, tails from the neonates were collected. Fetuses and neonates were killed by cold anesthesia on ice followed by decapitation.
Cytokine assay
Cytokine and chemokine concentrations were determined with a mouse 23-multiplex cytokine assay (Bio-Rad Laboratories Inc, Mississauga, Ontario, Canada) on a Luminex 200 cytometer and Bioplex HTF (Bio-Rad Laboratories Inc). The assay measured concentrations of interleukin (IL)-1α, -1β, -2, -3, -4, -5, -6, -9, -10, -12p40, -12p70, -13, and -17; interferon- γ ; CXCL 1; CCL2, 3, 4, 5, and 11; tumor necrosis factor alpha (TNFα), and CSF2 and 3. Data analysis was performed with Bio-Plex Manager software (version 5.0; Bio-Rad Laboratories Inc), and results are presented as concentrations (picograms per milliliter). Tissues were crushed and homogenized in ethylenediaminetetraacetic acid–free protease inhibitor that contained RIPA lysis buffer (1 mL per 0.5 g of tissue; Thermo Fisher Scientific Inc, Rockford, IL). Homogenized samples were left on ice for 45 minutes before being centrifuged at 12,000 g for 15 minutes at 4°C to collect the supernatant. Protein concentration was measured by Bradford assay kit (Bio-Rad Laboratories Inc) with bovine serum albumin as standard; 250 μg of total protein was used for the measurement of cytokines/chemokines in myometrium and placenta tissues.
Maternal progesterone measurement
Plasma progesterone concentration was measured with an Enzyme Immunoassay kit (Cayman Chemical Co, Ann Arbor, MI). Samples were diluted 400X with enzyme immunoassay buffer and assayed in duplicate. The intra- and interassay coefficients of variation were 6.9% and 12.1%, respectively.
Sex determination by polymerase chain reaction
DNA extracted from individual fetal tails was amplified using Sigma REDExtract-N-Amp Tissue polymerase chain reaction kit (XNAT; Sigma Chemical Company, St. Louis, MO). The isolated was amplified with primers Jarid1d FWD: GCACAGGACCTCAGGGACCCAG, Jarid1d REV: CAGAGGCATTCATCGATGAGG, Jarid 1c REV2: TGAGTTGGTACGACGAAGCTGCAG. Polymerase chain reaction–amplified products were resolved with a 2% agarose gel. Double bands (331 and 302 base pairs) were seen for males, and a single band (331 base pairs) was seen for females. Sex ratio was calculated by expressing the number of male fetuses over total number of fetuses.
Statistical analysis
Statistical analysis was carried out with SigmaStat software (version 3.5; SigmaStat, San Jose, CA). Comparison of PTB rate was made with Fisher exact analyses (2-tailed). Unpaired Student t test, 2-tailed, was used to compare sex ratios. Data were tested for normality and equal variance. Comparison of cytokine, chemokine, and progesterone concentrations in multiple groups were carried out with 1-way analysis of variance or analysis of variance on ranks followed by Student Newman Keuls test as post hoc test. Data were expressed as mean values ± SEM. Data with a false discovery rate–adjusted probability value of < .05 were considered statistically significant.
Results
GR-1 supernatant reduced lipopolysaccharide-induced PTB
Intrauterine injection of lipopolysaccharide on gestational day 15 resulted in dose-dependent PTB within 48 hours ( Figure 1 ). GR-1 supernatant significantly reduced the rate of PTB from 94% (16/17) in the lipopolysaccharide 125 μg–treated group to 57% (8/14) in the lipopolysaccharide 125μg + GR-1 supernatant group ( P = .028; Figure 2 ). One mouse in the lipopolysaccharide 125 μg–treated group had all fetuses resorbed at term. Four of 6 mice in the lipopolysaccharide 125 μg + GR-1 supernatant group delivered live pups at term; in the remaining 2 mice, all fetuses had resorbed at term. All animals in the saline solution and GR-1 supernatant control groups delivered live pups at term. There was no difference in average fetal weight and litter size for mice that delivered at term between the different treatment groups.
GR-1 supernatant attenuated lipopolysaccharide induced cytokines and chemokines (group 3)
Baseline proinflammatory cytokine concentrations (IL-1α, -1β, and -12p70) and lipopolysaccharide-induced increases (IL-1α, -1β, -6, and -17) were highest in the myometrium ( Table 1 ). Compared with other compartments, baseline chemokine concentrations (CXCL1, CCL2, CCL3, CCL4, CCL5, CCL11) were low in the maternal plasma, but their production increased markedly (CCL2, CCL4, CCL5) with lipopolysaccharide stimulation (57-186 fold). Lipopolysaccharide increased both IL-4 and -10 concentrations in all compartments, except amniotic fluid ( Table 1 ). Among all cytokines that were measured, IL-6 and CSF3 had the greatest increases after lipopolysaccharide treatment.
| Cytokine/chemokine | Maternal plasma | Myometrium | Amniotic fluid | Placenta |
|---|---|---|---|---|
| IL-1α | 9.8 ± 2.4 (7) | 679.6 ± 170.6 (174) | 1.8 ± 0.6 (26) | 357.2 ± 222.8 (3) |
| IL-1β | 43.6 ± 4.2 (4) | 174.9 ± 19.7 (37) | 71.9 ± 8.7 (1) | 39.5 ± 9.3 (22) |
| IL-2 | 4.9 ± 1.3 (4) | 0.2 ± 0.1 (33) | 5.3 ± 0.9 (0.5) | <OOR (OOR) |
| IL-3 | 0.1 ± 0.01 (16) | 7.4 ± 2.9 (2) | 7.9 ± 1.5 (1) | 1.1 ± 0.2 (6) |
| IL-4 | 0.7 ± 0.1 (4) | 1.1 ± 0.2 (4) | 3.5 ± 0.6 (1) | 0.9 ± 0.1 (3) |
| IL-5 | 5.9 ± 2.5 (3) | 2.4 ± 0.4 (6) | <OOR (OOR) | 2.6 ± 0.7 (2) |
| IL-6 | 11.8 ± 1.8 (110) | 6.2 ± 1.2 (275) | 9.3 ± 1.1 (190) | 5.7 ± 0.7 (28) |
| IL-9 | <OOR (OOR) | 331.5 ± 93.8 (1) | <OOR (OOR) | 164.6 ± 11.2 (3) |
| IL-10 | 7.6 ± 3.6 (26) | 9.5 ± 1.3 (4) | 25.8 ± 3.7 (1) | 8.2 ± 1.4 (3) |
| IL-12p40 | 37.0 ± 6.0 (37) | 34.1 ± 15.1 (11) | 58.5 ± 6.3 (1) | 92.0 ± 29.6 (2) |
| IL-12p70 | 24.0 ± 7.1 (3) | 86.1 ± 21.1 (5) | 69.9 ± 11.3 (1) | 18.8 ± 4.0 (5) |
| IL-13 | 21.6 ± 4.1 (4) | 18.1 ± 3.3 (11) | 75.1 ± 15.3 (1) | 16.6 ± 3.0 (6) |
| IL-17 | 4.4 ± 1.3 (3) | 4.2 ± 1.6 (15) | 3.5 ± 0.9 (2) | 0.9 ± 0.3 (7) |
| CSF2 | 19.2 ± 1.0 (4) | 57.6 ± 9.3 (5) | 52.2 ± 3.9 (2) | 11.4 ± 3.1 (16) |
| CSF3 | 2409.5 ± 289.8 (63) | 437.2 ± 142.5 (449) | 214.8 ± 72.4 (288) | 478.7 ± 96.0 (390) |
| Interferon-γ | 0.6 ± 0.1 (19) | 5.1 ± 0.6 (3) | 3.0 ± 0.3 (1) | <OOR (OOR) |
| CXCL1 | 48.1 ± 8.7 (77) | 116.3 ± 51.7 (OOR) | 56.1 ± 4.7 (220) | 1855.3 ± 142.2 (OOR) |
| CCL2 | 50.7 ± 14.1 (149) | 132.2 ± 40.0 (138) | 1508.2 ± 157.1 (2) | 77.8 ± 20.0 (8) |
| CCL3 | 1.4 ± 0.3 (48) | 47.2 ± 14.8 (49) | 21.6 ± 4.9 (10) | 67.2 ± 13.6 (15) |
| CCL4 | 2.7 ± 0.7 (57) | 31.8 ± 5.5 (9) | 10.4 ± 1.7 (37) | 15.3 ± 1.4 (4) |
| CCL5 | 8.7 ± 2.4 (186) | 6.6 ± 1.3 (49) | 10.1 ± 0.8 (7) | 1.9 ± 0.6 (8) |
| CCL11 | 183.8 ± 33.5 (5) | 227.8 ± 30.0 (4) | 618.8 ± 26.5 (1) | <OOR (OOR) |
| Tumor necrosis factor–α | 19.3 ± 2.3 (4) | 38.4 ± 11.3 (3) | 51.0 ± 6.0 (3) | 7.5 ± 1.4 (5) |
Lipopolysaccharide significantly increased IL-1α, -6, and -12p70; TNFα; CCL2, 3, 4, and 5, and CSF2 and 3 in the maternal plasma ( Table 2 ), myometrium ( Table 3 ), amniotic fluid ( Table 4 ), and placenta ( Table 5 ), respectively. Lipopolysaccharide also significantly increased IL-1β, -10, -13, -12p40, and -17, CCL11, and interferon-γ in the maternal plasma and myometrium ( Tables 2 and 3 ), but not in the amniotic fluid ( Table 4 ). These cytokines/chemokines were also elevated significantly in the placenta after lipopolysaccharide, except for interferon-γ and CCL11 that were below detection limits ( Table 5 ). Lipopolysaccharide increased IL-2, -4, I-5, and -9 and CXCL1 to various degrees in tissues and fluids ( Tables 2-5 ). IL-5 in the amniotic fluid and IL-9 in the plasma and amniotic fluid were below the limits of assay detection.
| Maternal plasma cytokine | Saline solution | L rhamnosus GR-1 supernatant | LPS 125 μg | LPS 125 μg + L rhamnosus GR-1 supernatant |
|---|---|---|---|---|
| IL-1α | 9.8 ± 2.4 a | 16.7 ± 4.0 a | 69.5 ± 6.0 b | 72.5 ± 9.4 b |
| IL-1β | 43.6 ± 4.2 a | 56.0 ± 7.9 a | 181.2 ± 21.9 b | 98.8 ± 8.2 c |
| IL-2 | 4.9 ± 1.3 a | 4.9 ± 1.4 a | 17.6 ± 4.1 b | 16.7 ± 0.9 b |
| IL-3 | 0.1 ± 0.01 a | 0.1 ± 0.01 a | 1.6 ± 0.3 b | 0.9 ± 0.1 b |
| IL-4 | 0.7 ± 0.1 a | 0.7 ± 0.1 a | 2.9 ± 0.7 b | 2.2 ± 0.3 b |
| IL-5 | 5.9 ± 2.5 a | 3.4 ± 0.3 a | 16.5 ± 4.3 b | 8.9 ± 1.2 b |
| IL-6 | 11.8 ± 1.8 a | 12.6 ± 1.8 a | 1300.0 ± 324.4 b | 362.8 ± 74.9 c |
| IL-9 | <OOR | <OOR | <OOR | <OOR |
| IL-10 | 7.6 ± 3.6 a | 10.8 ± 1.8 a | 196.5 ± 27.2 b | 224.5 ± 33.6 b |
| IL-12p40 | 37.0 ± 6.0 a | 43.2 ± 4.7 a | 1384.8 ± 280.8 b | 278.1 ± 74.9 c |
| IL-12p70 | 24.0 ± 7.1 a | 19.2 ± 8.3 a | 64.4 ± 13.9 b | 37.5 ± 7.6 b |
| IL-13 | 21.6 ± 4.1 a | 30.9 ± 3.5 a | 76.9 ± 6.1 b | 65.8 ± 4.1 b |
| IL-17 | 4.4 ± 1.3 a | 2.3 ± 0.4 a | 13.9 ± 1.1 b | 14.4 ± 2.7 b |
| CSF2 | 19.2 ± 1.0 a | 27.3 ± 3.9 a | 85.8 ± 3.7 b | 93.2 ± 3.6 b |
| CSF3 | 2409.5 ± 289.8 a | 3338.3 ± 515.1 a | 150,981.9 ± 32,647.3 b | 233,038.8 ± 63,249.0 b |
| Interferon-γ | 0.6 ± 0.1 a | 0.8 ± 0.2 a | 11.5 ± 2.9 b | 18.3 ± 6.9 b |
| CXCL1 | 48.1 ± 8.7 a | 37.5 ± 8.9 a | 3702.7 ± 748.8 b | 3366.0 ± 1096.5 b |
| CCL2 | 50.7 ± 14.1 a | 132.9 ± 34.7 a | 7570.9 ± 1186.8 b | 5916.8 ± 833.6 b |
| CCL3 | 1.4 ± 0.3 a | 3.6 ± 1.2 a | 66.9 ± 4.3 b | 57.8 ± 7.4 b |
| CCL4 | 2.7 ± 0.7 a | 3.6 ± 0.5 a | 136.3 ± 18.9 b | 45.7 ± 8.0 c |
| CCL5 | 8.7 ± 2.4 a | 15.4 ± 3.8 a | 1622.4 ± 182.3 b | 922.1 ± 45.0 c |
| CCL11 | 183.8 ± 33.5 a | 121.7 ± 32.3 a | 831.8 ± 91.5 b | 754.2 ± 175.3 b |
| Tumor necrosis factor–α | 19.3 ± 2.3 a | 25.3 ± 3.4 a | 80.3 ± 11.1 b | 50.6 ± 2.4 c |
| Myometrium cytokine | Saline solution | L rhamnosus GR-1 supernatant | LPS 125 μg | LPS 125 μg + L rhamnosus GR-1 supernatant |
|---|---|---|---|---|
| IL-1α | 679.6 ± 170.6 a | 974.8 ± 70.2 a | 118,194.4 ± 112,940.0 b | 34,851.9 ± 20,441.5 b |
| IL-1β | 174.9 ± 19.7 a | 373.8 ± 117.8 a | 6,422.0 ± 837.8 b | 4991.7 ± 1111.0 b |
| IL-2 | 0.2 ± 0.1 a | 0.19 ± 0.1 a | 6.6 ± 3.9 b | 4.1 ± 1.4 b |
| IL-3 | 7.4 ± 2.9 a,b | 6.2 ± 2.5 a | 15.6 ± 2.3 b | 10.2 ± 1.3 a,b |
| IL-4 | 1.1 ± 0.2 a | 1.6 ± 0.1 a | 4.4 ± 0.4 b | 3.8 ± 0.2 b |
| IL-5 | 2.4 ± 0.4 a | 4.3 ± 1.6 a | 13.5 ± 7.2 b | 9.8 ± 3.5 b |
| IL-6 | 6.2 ± 1.2 a | 12.1 ± 2.3 a | 1,704.4 ± 494.6 b | 291.1 ± 67.5 c |
| IL-9 | 331.5 ± 93.8 a | 248.5 ± 113.1 a | 329.6 ± 72.5 a | 196.5 ± 85.5 a |
| IL-10 | 9.5 ± 1.3 a | 8.9 ± 0.5 a | 36.9 ± 4.3 b | 37.8 ± 4.8 b |
| IL-12p40 | 34.1 ± 15.1 a | 35.5 ± 6.3 a | 362.9 ± 81.0 b | 400.3 ± 121.9 b |
| IL-12p70 | 86.1 ± 21.1 a | 99.0 ± 19.2 a | 400.4 ± 39.3 b | 295.4 ± 36.7 c |
| IL-13 | 18.1 ± 3.3 a | 24.7 ± 5.9 a | 206.8 ± 21.5 b | 133.1 ± 19.3 c |
| IL-17 | 4.2 ± 1.6 a | 3.8 ± 1.4 a | 63.0 ± 16.7 b | 16.2 ± 3.3 c |
| CSF2 | 57.6 ± 9.3 a | 58.2 ± 7.9 a | 313.4 ± 50.2 b | 168.8 ± 15.0 c |
| CSF3 | 437.2 ± 142.5 a | 1434.5 ± 834.1 a | 196,003.8 ± 66,522.5 b | 184,154.1 ± 118,930.5 b |
| Interferon-γ | 5.1 ± 0.6 a | 4.6 ± 0.9 a | 17.8 ± 1.3 b | 13.9 ± 1.3 c |
| CXCL1 | 116.3 ± 51.7 | 232.8 ± 118.9 | OOR> | 39,265.4 ± 6,534.7 |
| CCL2 | 132.2 ± 40.0 a | 195.2 ± 82.5 a | 18,245.8 ± 5702.7 b | 45,343.6 ± 23,004.8 b |
| CCL3 | 47.2 ± 14.8 a | 148.4 ± 49.7 a | 2299.8 ± 471.2 b | 1981.6 ± 349.7 b |
| CCL4 | 31.8 ± 5.5 a | 48.1 ± 12.1 a | 300.3 ± 53.9 b | 319.1 ± 86.4 b |
| CCL5 | 6.6 ± 1.3 a | 27.5 ± 10.7 a | 325.7 ± 46.8 b | 313.8 ± 72.9 b |
| CCL11 | 227.8 ± 30.0 a | 233.5 ± 23.5 a | 861.7 ± 203.5 b | 670.7 ± 154.4 b |
| Tumor necrosis factor–α | 38.4 ± 11.3 a | 32.6 ± 10.5 a | 128.7 ± 19.2 b | 78.8 ± 10.6 a |
| Amniotic fluid cytokine | Saline solution | L rhamnosus GR-1 supernatant | LPS 125 μg | LPS 125 μg + L rhamnosus GR-1 supernatant |
|---|---|---|---|---|
| IL-1α | 1.8 ± 0.6 a | 2.6 ± 1.1 a | 46.4 ± 9.1 b | 35.8 ± 8.7 b |
| IL-1β | 71.9 ± 8.7 a | 75.5 ± 11.2 a | 75.9 ± 13.3 a | 65.4 ± 9.0 a |
| IL-2 | 5.3 ± 0.9 a | 5.5 ± 0.4 a | 2.9 ± 0.5 b | 3.7 ± 0.7 a,b |
| IL-3 | 7.9 ± 1.5 a | 7.6 ± 1.3 a | 10.2 ± 1.6 a | 7.9 ± 1.6 a |
| IL-4 | 3.5 ± 0.6 a,b | 1.9 ± 0.3 b | 5.1 ± 0.9 a,c | 4.0 ± 0.9 a,b,c |
| IL-5 | <OOR | <OOR | <OOR | <OOR |
| IL-6 | 9.3 ± 1.1 a | 9.2 ± 0.9 a | 1767.4 ± 584.6 b | 365.6 ± 35.9 c |
| IL-9 | <OOR | <OOR | <OOR | <OOR |
| IL-10 | 25.8 ± 3.7 a,b | 22.7 ± 3.0 b | 40.6 ± 5.6 a,c | 33.0 ± 4.4 a,b,c |
| IL-12p40 | 58.5 ± 6.3 a | 51.3 ± 5.0 a | 73.0 ± 6.7 a | 65.2 ± 5.8 a |
| IL-12p70 | 69.9 ± 11.3 a,b | 46.7 ± 7.8 b | 93.1 ± 7.4 a,c | 76.3 ± 8.5 a,b,c |
| IL-13 | 75.1 ± 15.3 a | 90.8 ± 13.1 a | 112.4 ± 15.9 a | 77.3 ± 8.5 a |
| IL-17 | 3.5 ± 0.9 a | 2.0 ± 0.7 a | 6.2 ± 1.6 a | 4.1 ± 1.0 a |
| CSF2 | 52.2 ± 3.9 a | 49.7 ± 4.9 a | 97.6 ± 15.0 b | 88.3 ± 8.6 b |
| CSF3 | 214.8 ± 72.4 a | 297.9 ± 118.6 a | 61,939.9 ± 28,767.9 b | 33,742.1 ± 11,824.3 b |
| Interferon-γ | 3.0 ± 0.3 a | 4.2 ± 0.5 a | 4.7 ± 0.8 a | 4.0 ± 0.4 a |
| CXCL1 | 56.1 ± 4.7 a | 65.9 ± 12.8 a | 12,298.9 ± 3378.9 b | 9714.0 ± 3461.3 b |
| CCL2 | 1508.2 ± 157.1 a | 1251.1 ± 113.3 a | 3538.2 ± 819.7 b | 2678.4 ± 538.3 b |
| CCL3 | 21.6 ± 4.9 a | 23.2 ± 3.5 a | 222.8 ± 33.8 b | 75.5 ± 16.4 c |
| CCL4 | 10.4 ± 1.7 a | 13.2 ± 2.0 a | 389.5 ± 138.1 b | 138.1 ± 47.9 c |
| CCL5 | 10.1 ± 0.8 a | 8.4 ± 0.8 a | 66.6 ± 11.5 b | 47.3 ± 8.9 b |
| CCL11 | 618.8 ± 26.5 a | 572.8 ± 82.4 a | 578.6 ± 116.2 a | 481.7 ± 94.9 a |
| Tumor necrosis factor–α | 51.0 ± 6.0 a | 40.3 ± 3.3 a | 162.8 ± 17.5 b | 89.5 ± 16.4 c |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
