Objective
Oxidative stress plays a causal role in diabetic embryopathy. Maternal diabetes induces heart defects and impaired transforming growth factor beta (TGFβ) signaling, which is essential for cardiogenesis. We hypothesize that mitigating oxidative stress through superoxide dismutase 1 (SOD1) overexpression in transgenic (Tg) mice reverses maternal hyperglycemia-impaired TGFβ signaling and its downstream effectors.
Study Design
Day 12.5 embryonic hearts from wild-type (WT) and SOD1 overexpressing embryos of nondiabetic (ND) and diabetic mellitus (DM) dams were used for the detection of oxidative stress markers: 4-hydroxynonenal (4-HNE) and malondlaldehyde (MDA), and TGFβ1, 2, and 3, phosphor (p)-TGFβ receptor II (TβRII), p-phosphorylated mothers against decapentaplegic (Smad)2, and p-Smad3. The expression of 3 TGFβ-responsive genes was also assessed. Day 11.5 embryonic hearts were explanted and cultured ex vivo, with or without treatments of a SOD1 mimetic (Tempol; Enzo Life Science, Farmingdale, NY) or a TGFβ recombinant protein for the detection of TGFβ signaling intermediates.
Results
Levels of 4-HNE and MDA were significantly increased by maternal diabetes, and SOD1 overexpression blocked the increase of these 2 oxidative stress markers. Maternal diabetes suppresses the TGFβ signaling pathway by down-regulating TGFβ1 and TGFβ3 expression. Consequently, phosphorylation of TβRII, Smad2, and Smad3, downstream effectors of TGFβ, and expression of 3 TGFβ-responsive genes were reduced by maternal diabetes, and these reductions were prevented by SOD1 overexpression. Treatment with Tempol or TGFβ recombinant protein restored high-glucose–suppressed TGFβ signaling intermediates and responsive gene expression.
Conclusion
Oxidative stress mediates the inhibitory effect of hyperglycemia in the developing heart. Antioxidants, TGFβ recombinant proteins, or TGFβ agonists may have potential therapeutic values in the prevention of heart defects in diabetic pregnancies.
Preexisting maternal diabetes increases the risk of congenital heart defects in the offspring. Major cardiac defects including persistent truncus arteriosus and ventricular septal defects are often seen in offspring of diabetic women. Because the number of women of reproductive age (18–44 years old) with diabetes is increasing, diabetes-induced heart defects have become an urgent health problem.
The critical exposure period for diabetes-induced birth defects is during organogenesis, which occurs during gestational stage 2–8 weeks in humans and corresponds approximately to embryonic day (E) 8.5 to E12.5 in the mouse. Investigations using rodent models of diabetic embryopathy have revealed many important insights into the signal transduction factors that may cause diabetic embryopathy, particularly those involved in diabetes-induced neural tube defects (NTDs). However, information regarding diabetes-induced alterations in cardiac development signal transduction is limited.
Transforming growth factor β (TGFβ) signaling plays an important role in early embryonic cardiac development, especially in the formation of the cardiac cushions between E8.5 and E12.5 in the mouse. TGFβ ligands (TGFβ1, TGFβ 2, TGFβ 3) bind to the TGFβ type II receptor (TβRII) at the cell surface, causing it to be activated by phosphorylation and then, in turn, to recruit and phosphorylate TGFβ type I receptor (TβRI). TβRI phosphorylation causes phosphorylation of phosphorylated mothers against decapentaplegic (Smad)2 and Smad3 proteins, enabling their migration to the nucleus (in association with Smad4) to regulate the transcription of TGFβ target genes.
Maternal diabetes suppresses TGFβ signaling, which prevents this cascade from occurring, and may contribute to hyperglycemia-induced heart malformations. The mechanism linking impaired TGFβ signaling to heart defects in offspring of diabetic mothers has not been explored. However, previous work suggests a strong correlation between TGFβ signaling and cardiac development. For example, TGFβ1 is responsible for smooth muscle development in the cardiac outflow tract. In addition, eliminating TGFβ2 via knockout leads to cardiac outflow septum defects in mice, and deleting TβRII in mice causes cardiac cushion fusion defects and ventricular septal defect formation.
In the developing embryo, maternal diabetes induces mitochondrial dysfunction, enhances cellular reactive oxygen species (ROS) production, and impairs cellular antioxidant defense capabilities leading to oxidative stress. Several studies in animal models have shown the effectiveness of using antioxidant supplementations to prevent diabetes-induced NTDs and heart defects. Superoxide dismutase 1 (SOD1) 1 is an endogenous antioxidant enzyme that detoxifies superoxide. Our previous studies have demonstrated that mitigating oxidative stress through SOD1 overexpression in mouse embryos ameliorates maternal diabetes-induced NTD formation.
It has been reported that oxidative stress can either inhibit or enhance the TGFβ signaling pathway in different model systems. The relationship between oxidative stress and TGFβ signaling in the developing heart under diabetic conditions is unknown. In the present study, we examined the effect of maternal diabetes in vivo and high glucose ex vivo on the TGFβ signaling and used the SOD1-transgenic (Tg) mice and a SOD1 mimetic to assess the role of oxidative stress in mediating the inhibitory effect of hyperglycemia on TGFβ signaling.
Material and Methods
Animals and reagents
C57BL/6J mice (average body weight 22 g) were purchased from Jackson Laboratory (Bar Harbor, ME). SOD1-Tg mice in a C57BL/6J background were revived from frozen embryos by the Jackson Laboratory (stock no. 00298). Streptozotocin from Sigma (St. Louis, MO) was dissolved in sterile 0.1 M citrate buffer (pH 4.5). Sustained-release insulin pellets were purchased from Linplant (Linshin, Canada).
Mouse models of diabetic embryopathy
All procedures for animal use were approved by the Institutional Animal Care and Use Committee of the University of Maryland School of Medicine. Eight week old wild-type (WT) female mice were intravenously injected daily with 75 mg/kg streptozotocin over 2 days to induce diabetes. Blood glucose levels were monitored daily by tail vein puncture and using a FreeStyle blood glucose monitoring system (TheraSense; Abbot, Alameda, CA). Mice were considered as having diabetes when their blood glucose levels were greater than or equal to 14 mM. Insulin pellets were then subcutaneously implanted in diabetic mice to restore euglycemia prior to mating to protect early embryonic formation and implantation. Mice were then mated with SOD1-Tg male mice at 3:00 pm to generate WT and SOD1-overexpressing embryos.
E0.5 was designated once the vaginal plug was present on the next morning. On E5.5, insulin pellets were removed to permit frank hyperglycemia (>14 mM glucose levels) and exposure of the developing embryos to a hyperglycemic conditions from E7 to E12, which is critical period for early heart development. WT, nondiabetic, female mice injected with vehicle and sham operated on for insulin pellet implantation served as nondiabetic controls. On E12.5, mice were euthanized, and embryonic hearts were dissected out of the embryos for analysis.
Ex vivo embryonic heart culture
Ex vivo embryonic heart culture was performed and modified according to the recent publication by Hashimoto et al. Briefly, E11.5 hearts from nondiabetic WT (ND-WT) dams were quickly explanted and placed in a 24 well plate coated with collagen gel (A10483-01; Life Technologies, Grand Island, NY). The collagen gel was prepared in 5 mM (low glucose [LG]) or 25 mM (high glucose D-glucose in M199 culture media (M4530; Sigma) and hydrated by warmed Opti-MEM media, plus 1% fetal bovine serum (16140071; Gibco) and insulin-transferrin-selenium (ITS; 25-800-CR; Corning, Corning, NY).
After incubation overnight at 37°C in a humidified atmosphere of 5% CO 2 , M199 medium with 5 mM (LG) or 25 mM (high glucose) D-glucose plus 10% fetal bovine serum was added to the hearts and were cultured for 24 hours. Then hearts were treated with 5 mM Tempol (ALX-430-081-M250; Enzo Life Science, Farmingdale, NY) for 24 hours to suppress oxidative stress or with 50 ng/mL TGFβ1 recombinant protein (TP300973; Origene, Bethesda, MD) for 48 hours to rescue TGFβ signaling.
Western blotting
Western blotting was performed as previously described. Briefly, E12.5 hearts from different experimental groups were sonicated in 35 μL ice-cold lysis buffer (20 Mm Tis-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 10 mM NaF, 2 mM Na-orthovanadate, 1 mM pheylmethylsulfonyl fluoride, and 1% Triton X-100) containing protease inhibitor cocktail (Sigma). Equal amounts of protein were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto Immobilon-P membranes (Millipore, Bedford, MA).
Membranes were incubated for 12 hours at 4°C with the following primary antibodies at 1:1000 to 1:2000 dilutions in 5% nonfat milk: anti-TGFβ; anti-TβRII with/without phosphorylation; anti-Smad2 with/without phosphorylation; anti-Smad3 with/without phosphorylation; anti-SOD1 (Cell Signaling, Beverly, MA); and anti-β-actin (Abcam, Cambridge, MA).
Signals were detected using a SuperSignal West Femto maximum sensitivity substrate kit (Thermo Scientific, Rockford, IL). Chemiluminescence emitted from the bands was directly captured using a UVP Bioimage EC3 system (UVP, Upland, CA). Densitometric analysis of chemiluminescence signals was performed by VisionWorks LS software (UVP).
Real-time polymerase chain reaction
Total RNA was isolated from E12.5 embryonic hearts using an RNeasy minikit (QIAGEN, Valencia, CA). Real-time PCRs for TGFβ1 , TGFβ2 , TGFβ3 , Snai2 (snail homolog 2), CTGF (connective tissue growth factor), GDF1 (growth differentiation factor 1), and β-actin were performed using Maxima SYBR Green/ROX quantitative PCR master mix assay (Thermo Scientific). Real-time polymerase chain reaction (RT-PCR) and subsequent calculations were performed by a 7700 ABI PRISM sequence detector system (Applied Biosystems, Foster City, CA). Primer sequences for the RT-PCR are listed in the Table .
| Primer name | Primer source | Primer sequence |
|---|---|---|
| TGFβ1F | Primerbank ID, 6755775a1 | CTCCCGTGGCTTCTAGTGC |
| TGFβ1R | GCCTTAGTTTGGACAGGATCTG | |
| TGFβ2F | Primerbank ID, 6678317a1 | TCGACATGGATCAGTTTATGCG |
| TGFβ2R | CCCTGGTACTGTTGTAGATGGA | |
| TGFβ3F | Primerbank ID, 6678319a1 | CCTGGCCCTGCTGAACTTG |
| TGFβ3R | TTGATGTGGCCGAAGTCCAAC | |
| Snai2F | Primerbank ID, 6755576a1 | TGGTCAAGAAACATTTCAACGCC |
| Snai2R | GGTGAGGATCTCTGGTTTTGGTA | |
| CTGFF | Primerbank ID, 6753878a1 | GGGCCTCTTCTGCGATTTC |
| CTGFR | ATCCAGGCAAGTGCATTGGTA | |
| GDF1F | Primerbank ID, 6679977a1 | AACTAGGGGTCGCCGGAAA |
| GDF1R | TCAAAGACGACTGTCCACTCG |
Immunostaining
Embryonic hearts were fixed in 4% paraformaldehyde overnight followed by embedding in optimum cutting temperature compound (Sakura Finetek, Torrance, CA). Ten micrometer heart cryosections were antigen unmasked using citrate buffer and blocked in 5% bovine serum albumin in a buffer of 0.1% Triton X-100 in phosphate-buffered saline for 1 hour. The following antibodies were used as primary antibodies: phosphorylated (p) Smad2 (1:200; Cell Signaling Technology), p-Smad3 (1:200; Cell Signaling Technology), p-histone H3 (1:100; Millipore). Normal rabbit or mouse IgG at the same dilutions as those for antibodies were used as controls.
Sections were counterstained with 4′,6′-diamino-2-phenylindole (DAPI) and mounted with aqueous mounting medium (Sigma). Images were captured using an inverted microscope (Nikon Eclipse E1000M; Nikon, Tokyo, Japan). For the evaluation of cell proliferation, p-histone H3–positive cells were counted on 3 heart sections per group.
Statistics
Data were presented as means ± SE. Analysis of variance with a Tukey test was used to identify significant differences when appropriate. A difference of P < .05 was considered to be statistically significant.
Results
SOD1 overexpression blocks maternal diabetes–induced oxidative stress in the developing heart
Maternal diabetes produces ROS, results in oxidative stress, and induces lipid peroxidation and protein oxidization. To examine whether SOD1 overexpression could ameliorate maternal diabetes-induced oxidative stress in the embryonic heart, we tested the levels of 2 major lipid peroxidation markers, 4-hydroxynonenal (4-HNE) and malondialdehyde (MDA).
We found that the levels of these 2 markers were significantly higher in the embryonic heart from the diabetes mellitus wild-type (DM-WT) group when compared with the other 2 groups ( Figure 1 , A and B). SOD1-overexpressing embryonic hearts exposed to diabetes showed comparable levels of these 2 markers with WT embryonic hearts under nondiabetic condition ( Figure 1 , A and B). These results suggested that SOD1 overexpression significantly blocks maternal diabetes–induced oxidative stress in the developing heart.
SOD1 overexpression restores maternal diabetes–impaired TGFβ expression in the developing heart
To determine whether maternal diabetes affects the expression of TGFβs and whether oxidative stress participates in this process, the levels of 3 TGFβ ligands (TGFβ1, TGFβ2, TGFβ3) were analyzed in E12.5 embryonic hearts from the ND-WT, DM-WT, and diabetes mellitus–SOD1 (DM-SOD1) groups. Both mRNA and protein analyses showed that TGFβ1 and TGFβ3 were significantly decreased in embryonic hearts from the DM-WT group, compared with those from the ND-WT group, whereas TGFβ2 showed no significant change among these 2 groups ( Figure 2 , A and B). We further found that blocking oxidative stress by SOD1 overexpression could restore the expression levels of TGFβ1 and TGFβ3 suppressed by maternal diabetes ( Figure 2 , A and B), indicating that the down-regulation of TGFβs can be reversed by SOD1 overexpression.
SOD1 overexpression ameliorates maternal diabetes–impaired downstream TGFβ signaling intermediates in the developing heart
We next investigated whether maternal diabetes and oxidative stress could also affect the levels of TGFβ signaling cascades in the embryonic heart. We tested the protein levels of TβRII, Smad2, and Smad3 phosphorylation in the E12.5 embryonic hearts. The levels of p-TβRII, p-Smad2, and p-Smad3 were all significantly decreased in the DM-WT group and restored in the DM-SOD1 group ( Figure 3 , A-C). The immunostaining signals of p-Smad2 and p-Smad3 in the E12.5 embryonic hearts from the DM-WT group were lower than those from the ND-WT and DM-SOD1 groups ( Figure 3 , D).
SOD1 overexpression reverses maternal diabetes–decreased TGFβ signaling–responsive gene expression
We detected the expression level of 3 TGFβ responsive genes: snail homolog 2 ( Snai2 ), connective tissue growth factor ( CTGF ), and growth differentiation factor 1 ( GDF1 ). Maternal diabetes significantly decreased the expression of these 3 TGFβ-responsive genes in the developing heart, and SOD1 overexpression restored their expression levels suppressed by maternal diabetes ( Figure 4 ).
Tempol abolishes high glucose–impaired TGFβ signaling in ex vivo cultured embryonic hearts
Our results indicated that oxidative stress plays a key role in maternal diabetes-impaired TGFβ signaling in the developing heart. To further confirm this, we explanted E11.5 embryonic hearts and cultured them ex vivo in high glucose and Tempol (superoxide dismutase mimetic) conditions to check the effect of Tempol on high glucose–suppressed TGFβ signaling.
The p-histone H3 staining showed similar cell proliferation levels between the low glucose–cultured hearts (cultured for 3 days) and E12.5 WT embryonic hearts from ND dams, suggesting that culture medium can maintain explanted hearts very well for at least 3 days ( Figure 5 , A). Similar to our in vivo observations that overexpressing SOD1 rescued TGFβ signaling, Tempol treatment restored TGFβ, p-TβRΙΙ, p-Smad2, p-Smad3 ( Figure 5 , B), and 3 TGFβ-responsive genes ( Figure 5 , C) that were decreased by high glucose, suggesting that high glucose–induced oxidative stress suppresses the TGFβ signaling pathway.
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
