Background
The relative roles of the mother and fetus in signaling for labor remain poorly understood.
Objective
We previously demonstrated using gene knockout (KO) mice that Escherichia coli -induced preterm delivery is completely dependent on MyD88, a toll-like receptor adaptor protein. Here we leveraged this finding to conduct a genetic experiment testing whether the mother, the fetus, or both signal for parturition in bacterially induced labor.
Study Design
Six different maternal/fetal genotype combinations for MyD88 were studied: wild-type (WT) dams carrying one of the following: (1) WT or (2) MyD88 heterozygous (het) fetuses (generated by mating WT females with WT or MyD88-knockout [KO] males, respectively); (3) WT dams carrying MyD88-KO fetuses (generated by replacing the ovaries of WT females with MyD88-KO ovaries, followed by mating with MyD88-KO males); a similar strategy was used to generate MyD88-KO dams carrying (4) MyD88-KO, (5) MyD88 het, or (6) WT fetuses. On day 14.5 of gestation, mice received intrauterine injections of either 1 × 10 9 killed E coli or sterile medium. Delivery of ≥ 1 fetus within 48 hours was considered preterm. A separate group of similarly treated pregnant mice was euthanized 5 hours after surgery for gene expression and tissue analysis.
Results
E coli -induced preterm delivery is dependent on maternal and not fetal genotype: > 95% of WT and < 5% of MyD88-KO dams deliver prematurely, regardless of fetal genotype ( P = .0001). In contrast, fetal survival in utero is influenced by fetal genotype: in MyD88-KO dams, in which premature birth rarely occurs, only 81% of WT and 86% of MyD88-heterozygous fetuses were alive 48 hours after surgery compared with 100% of MyD88-KO fetuses ( P < .01). Messenger ribonucleic acids for the inflammatory mediators interleukin-1β, tumor necrosis factor, interleukin-6, and cyclooxygenase-2 were elevated in uterine tissues only in WT mothers treated with E coli and were low or undetectable in the uteri of KO mothers or in animals treated with saline. Serum progesterone levels were lower in KO mothers with WT ovaries than in WT mothers with KO ovaries, but bacterial exposure did not have an impact on these levels.
Conclusion
In the murine E coli -induced labor model, preterm delivery and uterine expression of inflammatory mediators is determined by the mother and not the fetus and is not attributable to a decline in serum progesterone.
Despite decades of research, the mechanisms underlying the initiation and maintenance of parturition are not well understood. In particular, the relative roles of the mother and fetus in initiating labor processes are not known. In simplistic terms: does the fetus signal that it is time to be delivered? Does the mother? Is there collaboration (cross talk) between mother and fetus to generate labor signals? What is the nature of these signals?
Recent studies conducted in the mouse provide evidence that the fetus initiates spontaneous labor at term through fetal expression of steroid receptor coactivator (SRC)-1 and SRC-2, which regulate fetal production of surfactant protein A, which in turn induces inflammatory pathways in maternal tissues. Whether a similar phenomenon occurs in humans remains to be determined, as does the answer to an additional question: when these processes occur at abnormal times (ie, prematurely), do they recapitulate normal term labor, or are there alternative pathways to parturition? Correct understanding of the mechanisms of parturition has obvious implications for developing interventions to treat preterm labor, a disorder that remains the major cause of neonatal morbidity and mortality worldwide and for which treatment options are limited.
Among the various factors that are associated with preterm labor, infection and inflammation represent significant primary causes. As many as 50% of preterm labor cases are associated with infection and/or inflammation within the gestational compartment (with a higher proportion at earlier gestational ages). Infection induces a cascade of molecular events, including activation of the innate immune system, with subsequent expression of inflammatory cytokines, prostaglandins, contraction-associated proteins, and ultimately end-organ phenomena characteristic of labor, including uterine contractions, cervical dilation, and rupture of fetal membranes.
We took advantage of an experimental model in which an absolute dependence of bacterially induced preterm delivery was previously demonstrated for the toll-like receptor (TLR) adaptor protein, myeloid differentiation primary response gene 88 (MyD88). MyD88 is a protein necessary for transduction of intracellular signals following engagement of most TLRs, which are membrane-bound receptors responsible for the activation of the innate immune response to molecular constituents of microbes (known as pathogen-associated molecular patterns). Such pathogen-associated molecular patterns include lipopolysaccharide (LPS; which is derived from Gram-negative bacteria and engages TLR4) and peptidoglycan (which is derived from Gram-positive bacteria and engages TLR2).
We showed previously that following the administration of an intrauterine inoculum of killed Escherichia coli sufficient to cause preterm delivery in 100% of wild-type pregnant mice, pregnant females deficient in MyD88 (knockout [KO]) and carrying MyD88-KO fetuses were completely protected from preterm delivery. This absolute requirement for MyD88 for the dichotomous outcome of preterm delivery allowed us to design an experiment to examine the relative roles of mother and fetuses in parturition by manipulation of maternal-fetal MyD88 genotype combinations.
Materials and Methods
Mice
All procedures involving animals were approved by the NorthShore University HealthSystem Animal Care and Use Committee and conform to the Guide for Care and Use of Laboratory Animals (1996, National Academy of Sciences). MyD88-deficient (KO) mice used in the present studies were from 2 sources: (1) a strain developed and contributed by Professor Shizuo Akira (Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan), which was on a mixed C57BL/6J-129 background ; and (2) a commercially obtained strain (B6.129P2[SJL]- Myd88 tm1.1Defr /J) backcrossed onto the inbred C57BL/6J line (The Jackson Laboratory, Bar Harbor, ME).
These 2 lines were used to account for possible effects because of background strain. Given that there were no differences between the 2 strains, the results for both were combined. Controls were B6129F2/J and C57BL/6J (The Jackson Laboratory), respectively, and were also combined, with no differences between the 2 strains. WT dams carrying WT and MyD88-heterozygous fetuses were created by mating WT females with either WT or MyD88-KO studs, respectively. In a similar fashion, MyD88-KO dams carrying MyD88-KO and MyD88-heterozygous fetuses were creating by mating MyD88-KO females with either MyD88-KO or WT studs.
To generate maternal-fetal genotype combinations not achievable in nature, ovarian transplants were performed, exchanging ovaries between WT and MyD88-KO mice. Doing so allows, through subsequent mating to appropriate male studs, for WT dams to carry MyD88-KO fetuses and for MyD88-KO dams to carry WT fetuses (see procedures in the following text).
Ovarian transplant procedure
To perform the ovarian exchange, one 3-4 week old WT female and one MyD88-KO female of similar age were anesthetized with ketamine (80-100 mg/kg) and xylazine (5-10 mg/kg). In each of these mice, a low dorsal midline skin incision was made and 1 ovary/oviduct/fat pad complex exposed ( Figure 1 ). An incision was made in the ovarian bursal membrane, the edges of which were teased away laterally to expose the ovary. A curved forceps was then inserted under the ovary, which was lifted bluntly out of the bursa and placed in room-temperature phosphate-buffered saline (PBS). A drop of 1% lidocaine-HCl mixed with epinephrine 1:100,000 was placed into the empty bursal sac to minimize blood loss.
Once 1 ovary from each of the WT and MyD88-KO mice had been excised, the transplant procedure was performed: the donated ovary was gently placed within the empty ovarian bursa, and the edges of the sac were pulled over its surface to maintain it in position. The ovarian complex was then returned to the abdominal cavity. After both animals had donated and received 1 ovary apiece, the identical procedures were done on the contralateral side.
The skin incision was closed with a single metal wound clip and the animals were allowed to awaken from anesthesia. Postoperative analgesia was provided with buprenorphine 0.1 μg/g (immediately after surgery) and meloxicam 2 μg/g (immediately after surgery and again 24 hours later). Animals were allowed to recover for at least 2 weeks prior to being mated for the pregnancy experiment.
Similar published protocols using fresh ovaries have produced high levels of fertility, with live offspring resulting from the transplanted ovary in 77-100% of cases The offspring of such pregnancies themselves exhibited normal reproductive capacity.
Bacterially induced preterm labor model
After recovery from ovarian transplantation, female mice in estrus were selected by the gross appearance of the vaginal epithelium and were mated. Mating was confirmed by the presence of a vaginal plug, and the morning of plug formation was counted as day 0.5 of pregnancy. The preterm labor experiment was performed on day 14.5 as previously described. Briefly, animals were anesthetized with 0.015 mL/g body weight of Avertin (2.5% tribromoethyl alcohol and 2.5% tert-amyl alcohol in PBS). A 1.5 cm midline incision was made in the lower abdomen.
In the mouse, the uterus is a bicornuate structure in which the fetuses are arranged in a beads-on-a-string pattern. Intrauterine injections of a 100 μL solution containing killed bacteria suspended in PBS (see the following text) or PBS only (controls) were performed in the midsection of the right uterine horn at a site between 2 adjacent fetuses, taking care not to inject individual fetal sacs. The abdomen was closed in 2 layers, with 4-0 polyglactin sutures at the peritoneum and wound clips at the skin.
Surgical procedures lasted approximately 10 minutes. Pregnant animals were excluded from the preterm labor experiment if there were fewer than 3 conceptuses in the injected uterine horn (n = 4). Animals recovered in individual, clean cages in the animal facility, and occurrence of preterm delivery and number of delivered conceptuses was determined. Preterm delivery was defined as delivery of 1 or more fetuses within 48 hours.
For the determination of delivery phenotype, animals were followed up through the earlier of delivery or 48 hours after surgery, at which time they were euthanized by CO 2 inhalation followed by necropsy for observation of retention and survival status of fetuses. Fetal remains in the cage and fetuses retained in utero were counted and correlated with the number of implantation sites (which remain easily visible in the mouse even after delivery).
Because cannibalization of pups by mothers is common, our usual practice is to consider a sudden drop in maternal girth without finding fetal remains in the cage presumptive evidence of delivery, to be confirmed at autopsy. This did not occur in the present study. Samples were obtained for the determination of fetal genotype (see below) from all conceptuses, whether they were retained in utero or delivered.
Tissue harvests were conducted using a separate group of mice treated identically, with necropsies performed 5 hours after surgery. The inoculated/right horn was incised longitudinally along the antimesenteric border. Uteri (from regions inclusive of the decidual caps underlying placental attachment sites) and placentas were harvested, washed in ice-cold PBS, flash-frozen in liquid nitrogen, and stored at –85°C for messenger RNA (mRNA) and protein extraction.
Bacterial preparation
Bacteria were prepared as previously described. A fresh culture of previously frozen E coli (number 12014; American Type Culture Collection, Manassas, VA) was grown overnight in 4000 mL Luria-Bertani broth. The overnight culture was concentrated by centrifugation and suspension in 10 mL of PBS. The concentration of this suspension was subsequently determined by plating serial dilutions in duplicate. The bacteria within the suspension were killed by immersion in a boiling water bath for 5 minutes and then frozen at –20°C. Killing was verified by lack of overnight growth on plates and in broth culture. Once the concentration of the frozen stock was known, it was thawed and diluted to 2 × 10 9 organisms per milliliter. This latter suspension was frozen at –80°C in aliquots and thawed and diluted as needed prior to each experiment.
MyD88 genotyping
To confirm that each pregnancy was conceived with gametes from the transplanted ovary and not from the native ovary, the genotypes of all fetuses conceived after ovarian transplantation were determined by polymerase chain reaction (PCR) of deoxyribonucleic acid (DNA) extracted from the fetal rump. These specimens were obtained postpartum from delivered offspring or at necropsy from fetuses retained in utero. The primer sequences were as follows: WT forward primer, GTTGTGTGTGTCCGACCGT; mutant forward primer, CCACCCTTGATGACCCCCTA; and common reverse primer, GTCAGAAACAACCACCACCATGC. Using these primers, the MyD88 WT amplicon was 266 bp in length and the MyD88 mutant amplicon was 520 bp.
Real-time PCR
Total RNA was extracted from homogenized tissues with TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. Five micrograms of total RNA were used as a template for complementary DNA (cDNA) synthesis. The cDNA was prepared using random primers and the Moloney murine leukemia virus reverse transcriptase system (Invitrogen, Carlsbad, CA).
All PCR primers and probes were purchased from Applied Biosystems (Foster City, CA) (interleukin [IL]-1β Mm00434228; IL-6 Mm00446190; chemokine C-C motif ligand 5 [CCL5] [regulated upon activation, normal T cell expressed, and secreted] Mm01302428; tumor necrosis factor [TNF] Mm00443258; cyclooxygenase-2 (COX-2) Mm00478374; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (20 times) 4452339E). Use of TaqMan PCR reagent kits was in accordance with the manufacturer’s manual (Applied Biosystems).
Reactions were performed in a 10 μL mixture containing 1 μL cDNA. Duplex reverse transcription-PCR (RT-PCR) was performed with one primer pair amplifying the gene of interest and the other an internal reference (GAPDH) in the same tube. Thermocycler parameters were 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, and 60°C for 1 minute. Semiquantitative analysis of gene expression was done using the comparative cycle threshold (ΔΔCT) method, normalizing the expression of the gene of interest to GAPDH. PCR assays were performed in triplicate.
Serum progesterone determination
Blood was collected by transthoracic cardiac puncture at necropsy. Serum was separated and stored at –80°. Enzyme-linked immunosorbent assays (ELISAs) for progesterone were performed using a progesterone ELISA kit (catalog number ADI-900-011; Enzo Life Sciences, Farmingdale, NY) according to the directions of the manufacturer and read at 405 nm with a microtiter plate reader.
Statistical methods
Categorical values were tested for statistical significance using a χ 2 test or a Fisher exact test. The normality assumption for continuous variables (expressed as means or medians) was assessed using the Shapiro-Wilk test. The Kruskal-Wallis test was used as global test (overall test for heterogeneity) for overall differences among groups. If the global test was significant, post-hoc pair-wise comparisons of medians among groups were performed as appropriate by multiple comparisons for nonnormally distributed data. The adjusted P values were computed using the permutation resampling rank test method. Statistical analysis was performed using the SAS version 9.3 platform (Cary, NC). A value of P < .05 indicates statistically significant differences.
Results
Confirmation of expected offspring genotypes after ovarian transplantation
The genotypes of all fetuses conceived after ovarian transplantation were determined by PCR to verify that each pregnancy was conceived with gametes from the transplanted ovary and not from the native ovary. In 86% of pregnancies in MyD88-KO dams (19 of 22) following ovarian transplantation with WT ovaries and subsequent mating with WT males, all fetuses in each litter had the expected genotype (ie, WT). In 9% of pregnancies (2 of 22), 1 fetal sample of the litter amplified both WT and KO sequences, and in 4.5% of pregnancies (1 of 22) all fetal samples amplified both WT and KO sequences.
Among pregnancies in WT dams following ovarian transplantation with KO ovaries and subsequent mating with KO males, the proportions of unexpected genotypes was higher: in 60% of pregnancies (15 of 25), all fetuses had the expected genotype (ie, MyD88-KO). In 12% (3 of 25), 1 fetal sample in the litter amplified both WT and KO sequences; in 16% (4 of 25), two fetal samples in the litter amplified both WT and KO sequences; and in 12% (3 of 25), all fetal samples in the litter amplified both WT and KO sequences.
The occurrences mentioned previously of unexpected fetal genotypes might have resulted from either retained endogenous maternal ovarian tissue or from contamination of the fetal specimens with maternal DNA. We believe the latter explanation is more likely because of the following considerations: (1) our confidence in the complete surgical excision of native ovaries; (2) the sensitivity of PCR, which would tend to artifactually amplify even minute amounts of contaminant; and (3) the fact that such discrepancies were more likely to occur in WT dams.
In WT but not KO dams, preterm labor occurred (see the following text), leading to either preterm delivery or significant resorption of fetal tissues, both of which increase the likelihood of maternal contamination. Nonetheless, to minimize concerns regarding the completeness of ovarian excision, animals were excluded if more than 1 fetus per litter had an unexpected genotype (ie, 7 of 47 litters), except in 1 case, in which a litter of 7 fetuses had 2 fetal samples with both WT and KO DNA.
E coli –induced preterm delivery is mediated by the mother and not the fetus
Table 1 shows the delivery outcomes of pregnancies for the various maternal-fetal genotype combinations following intrauterine inoculation with 10 9 killed E coli organisms. Preterm delivery was dictated by maternal genotype, regardless of fetal genotype (86-100% preterm delivery [pooled 96%] in WT mothers, whether fetuses were WT, heterozygous, or MyD88-KO, and 0-14% preterm delivery [pooled 4.5%] in MyD88-KO mothers, whether fetuses were KO, heterozygous, or WT).
| Maternal MyD88 genotype | Fetal MyD88 genotype | n | PTD rate, % | P value |
|---|---|---|---|---|
| WT | WT | 8 | 100 | |
| WT | Het | 7 | 86 | .3 |
| WT | KO | 8 | 100 | |
| KO | KO | 7 | 0 | |
| KO | Het | 7 | 14 | .3 |
| KO | WT | 8 | 0 | |
| P value | 0.0001 |
Table 2 shows effects of intrauterine inoculation on in utero fetal survival. In cases in which preterm delivery occurred (ie, in WT dams), approximately one third to two fifths of fetuses remained in utero, regardless of fetal genotype. None of these fetuses were alive at the time of necropsy. This result suggests that, regardless of fetal genotype, either bacterial exposure in a WT intrauterine environment or killed bacteria-induced preterm labor in and of itself leads to intrauterine fetal demise. In contrast, with bacterial exposure in the absence of labor (ie, in MyD88-KO dams), there was a significant effect of fetal genotype on survival (median survival 100% in MyD88-KO fetuses vs 86% and 81% in MyD88-heterozygous and WT fetuses, respectively [ P < .01]).
| Maternal MyD88 genotype | Fetal MyD88 genotype | n | Fetuses retained in utero per litter, median, % | P value | Fetuses alive in utero per litter, median, % | P value |
|---|---|---|---|---|---|---|
| WT | WT | 8 | 65 | 0 | ||
| WT | Het | 7 | 29 | .6 | 0 | .2 |
| WT | KO | 8 | 24 | 0 | ||
| KO | KO | 7 | 100 | 100 | ||
| KO | Het | 7 | 100 | .3 | 86 | .01 |
| KO | WT | 8 | 100 | 81 | ||
| P value | < .0001 | < .0001 |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
