Objective
The aim of this study was to examine the effects of 17-alpha-hydroxyprogesterone caproate (17OHP-C) on the activity and expression of several common hepatic cytochrome P450 (CYP) enzymes.
Study Design
Primary human hepatocytes were pretreated with vehicle or 17OHP-C (0.1 and 1 μmol/L) for 72 hours, then incubated for 1 hour with a cocktail of CYP substrates. The activity of various CYP enzymes was determined by measuring the formation of the metabolites of specific CYP substrates, using liquid chromatography–tandem mass spectrometry. The messenger RNA expression of various CYP enzymes was determined by real-time polymerase chain reaction.
Results
In primary cultures of human hepatocytes, 17OHP-C minimally altered the activity or messenger RNA levels of CYP1A2, CYP2C9, CYP2D6, and CYP3A. However, 17OHP-C at 1 μmol/L increased CYP2C19 activity by 2.8-fold ( P < .01) and CYP2C19 expression by 2.4-fold ( P < .001), compared with vehicle-treated cells. A strong positive correlation between activity and expression of CYP2C19 was also observed (r = 0.9, P < .001).
Conclusion
The activity and expression of hepatic CYP2C19 was significantly increased by 17OHP-C in primary cultures of human hepatocytes. This suggests that exposure to medications that are metabolized by CYP2C19 may be decreased in pregnant patients receiving 17OHP-C. Metabolism of substrates of CYP1A2, CYP2C9, CYP2D6, and CYP3A are not expected to be altered in patients receiving 17OHP-C.
The Food and Drug Administration (FDA) recently granted conditional approval for 17-alpha-hydroxyprogesterone caproate (17OHP-C) to prevent recurrent, spontaneous preterm birth in women with singleton gestations. Clinical pharmacokinetic studies in pregnant women have demonstrated an apparent half-life (around 16 days) and the trough maternal plasma concentrations (5-50 ng/mL) of 17OHP-C after intramuscular administration of a 250-mg dose. In vitro studies in human tissues and expressed enzymes have documented cytochrome P450 (CYP) 3A to be the primary enzyme responsible for the metabolism of 17OHP-C in human beings. One postmarketing commitment required by FDA is “an in vitro study in human hepatocytes to determine whether 17OHP-C induces or alters the metabolic activities of cytochrome P450s.” This requirement is based on the fact that during pregnancy women receiving 17OHP-C may receive a number of other medications to control various pregnancy-related complications or chronic disorders. These medications are commonly metabolized in the liver by the CYP enzymes. Therefore, it is essential to understand whether 17OHP-C has the ability to alter the metabolism of other coadministrated medications. This study was designed to evaluate the effects of 17OHP-C on the activity and expression of the major CYP enzymes, CYP1A2, CYP2C9, CYP2C19, CYP2D6, and CYP3A in primary cultures of human hepatocytes.
Materials and Methods
Chemicals
We purchased 17OHP-C from the US Pharmacopeia (Rockville, MD). Various CYP enzymes substrates, corresponding metabolites, and isotope-labeled internal standards were obtained from Sigma-Aldrich (St. Louis, MO) or Toronto Research Chemicals (Toronto, Ontario, Canada).
Primary cultures of human hepatocytes and treatment of 17OHP-C
Freshly isolated primary human hepatocytes (1.5 × 10 6 cells/well in 6-well plates) with viability >87% from 4 donors (ID: Hu1525, 1543, 1592, 1593) were purchased from Life Technologies (Carlsbad, CA). Upon receipt, media was replaced with HMM hepatocyte maintenance medium (Lonza, Allendale, NJ) containing 1 μmol/L dexamethasone, 4 μg/mL insulin, and 10,000 U/mL penicillin/streptomycin. Cells were maintained at 37°C in a humidified incubator with 5% carbon dioxide. After overnight incubation, cells were treated in duplicate with vehicle control (0.1% dimethyl sulfoxide), 17OHP-C (0.1 or 1 μmol/L), rifampin (10 μmol/L), or ketoconazole (10 μmol/L) for 3 days with once-a-day medium replacement. The quality of all hepatocytes used was validated by determining the magnitude of change caused by rifampin (a known CYP3A inducer) and ketoconazole (a known CYP3A inhibitor) on CYP3A-mediated testosterone 6β-hydroxylation. After 3 days of treatment, the medium was replaced with fresh HMM medium (Lonza) containing a cocktail of 5 CYP substrates (100 μmol/L phenacetin, 90 μmol/L diclofenac, 50 μmol/L S-mephenytoin, 20 μmol/L dextromethorphan, and 250 μmol/L testosterone) for 1 hour. At the end of the incubation, culture supernatant was sampled for the major metabolites formed from the 5 CYP substrates and total RNA was extracted from hepatocytes.
Determination of P450 activity
Metabolites formed were extracted using solid phase extraction and analyzed on a liquid chromatography–tandem mass spectrometry system, similar to our previously published method. Selected reaction monitoring in the positive-ion electrospray ionization mode was performed for acetaminophen (a metabolite of phenacetin produced by CYP1A2 activity), 4′-hydroxydiclofenac (a metabolite of diclofenac produced by CYP2C9 activity), 4′-hydroxymephenytoin (a metabolite of S-mephenytoin produced by CYP2C19 activity), dextrorphan (a metabolite of dextromethorphan produced by CYP2D6 activity), and 6β-hydroxytestosterone (a metabolite of testosterone produced by CYP3A activity) with ion pairs of m/z 152→110, 312→230, 235→150, 257→157, and 305→269. The lower limits of quantification for acetaminophen, 4′-hydroxydiclofenac, 4-hydroxymephenytoin, dextrorphan, and 6β-hydroxytestosterone were 0.1, 1, 2, 0.1, and 0.1 ng on-column. The assay was validated for specificity, precision (coefficients of variation ≤15%), and accuracy (≥85%). The concentration of respective generated metabolite in hepatocytes treated with 17OHP-C was compared to that in hepatocytes treated with vehicle control, to obtain the fold change in P450 activity.
RNA extraction and reverse transcription (real-time) polymerase chain reaction
Total RNA was extracted using TRIzol (Sigma-Aldrich) and further purified with RNasefree DNase I (Roche Applied Science, Indianapolis, IN). The concentration and purity of final RNA was determined photometrically with the ratio of the absorbance at 260 and 280 nm of 2. The complementary DNAs were synthesized using iScript Reverse Transcription Supermix for polymerase chain reaction (PCR) (Bio-Rad, Hercules, CA). Then, PCR was performed using an Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies) and Power SYBR Green PCR Mastermix (Bio-Rad). The following primers were used: aggtcaaccatgacccagag and agggcttgttaatggcagtg for CYP1A2, cctctggggcattatccatc and atatttgcacagtgaaacatagga for CYP2C9, cctcgggactttattgattgct and ccagctccaagtaagtcagc for CYP2C19, acaccatactgcttcgacca and cagcccattgagcacgac for CYP2D6, agagctcttcagaacttctcct and tctggttgaagaagtcctcct for CYP3A4, and ctcaagggcatcctgggctaca and tggtcgttgagggcaatgcc for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as housekeeping gene and oligonucleotides were from Integrated DNA Technologies (Coralville, IA). The PCR conditions were as follows. After an initial denaturation at 95°C for 10 minutes, amplification was performed by denaturation at 95°C for 15 seconds, and annealing and extension were performed at 60°C for 1 minute for 40 cycles. The dissociation curves were examined to ensure amplication of a single PCR product in the reaction. The copy number of P450 messenger RNA (mRNA) in the complementary DNA samples normalized to the GAPDH expression level according to the relative quantification method in presence of 17OHP-C was compared to that of vehicle control, to obtain the fold change in P450 expression.
Clinical relevance of indices of in vitro induction response
Based on the Pharmaceutical Research and Manufacturers of America perspective and FDA guidelines, 2 criteria for in vitro data were used to assign 17OHP-C as a probable inducer with clinical significance: (1) a ≥2-fold increase vs vehicle control, and (2) a ≥40% increase relative to rifampin induction level on CYP3A4/5.
Data analysis
Data were analyzed by 1-way analysis of variance with a Dunnett correction for multiple comparisons with vehicle control treatment. Linear associations between P450 activity and expression were expressed by the correlation coefficient. The P value of the null hypothesis that the overall slope of the regression line is 0 was calculated by the F test. Statistical analysis was performed with Stata software (version 11; StataCorp, College Station, TX).
Results
The metabolic capacity of the hepatocytes used was validated by determining the magnitude of change caused by rifampin (increase by 2.9- to 5.8-fold) and ketoconazole (decrease by 70–80%) on CYP3A-mediated testosterone 6β-hydroxylation. During the study period, there were no substantial morphological changes in the hepatocytes as observed microscopically. Based on previous studies, at concentrations used here 17OHP-C did not exhibit any cytotoxicity.
Figure 1 shows that in primary human hepatocytes, 17OHP-C significantly increased CYP1A2, CYP2C19, and CYP3A4/5 activity in a concentration-dependent manner. However, only CYP2C19 activity increased >2-fold in presence of 17OHP-C compared with that in vehicle-treated cells. CYP1A2 and CYP3A4/5 activities increased minimally by 1.4-fold and 1.3-fold only at 1 μmol/L concentration of 17OHP-C and with no effect at 0.1 μmol/L. The magnitude of increase in CYP3A4/5 activity by 1 μmol/L of 17OHP-C was only about 20% of the induction mediated by rifampin. No significant effect on the activity of CYP2C9 and CYP2D6 was observed in primary human hepatocytes treated with either concentration of 17OHP-C.
Figure 2 shows that in primary human hepatocytes, 17OHP-C increased CYP2C19 mRNA expression in a concentration-dependent manner: 2.0-fold increase ( P < .01) at 0.1 μmol/L and 2.4-fold increase ( P < .001) at 1 μmol/L of 17OHP-C, compared with vehicle-treated cells. Changes in mRNA expression of CYP1A2, CYP2C9, CYP2D6, and CYP3A4 were not statistically significant at either concentration of 17OHP-C.
Figure 3 shows a strong positive correlation between the activity and expression of CYP2C19 (r = 0.9, P < .001).
