Objective
We sought to determine whether CD11b + Gr1 + immature myeloid cells (IMCs), which have been shown to promote tumor angiogenesis, accumulate in the placenta and similarly contribute to blood vessel formation.
Study Design
Experiments were performed on 6- to 8-week-old C57Bl/6J female mice. Placentas from pregnant mice or B16F10 tumors that were subcutaneously implanted were analyzed by flow cytometry and confocal microscopy. To determine the proangiogenic potential of IMCs, Matrigel plug assays were performed.
Results
IMCs infiltrate the placenta in the proximity of blood vessels, reaching peak concentration at midpregnancy. When isolated from either placentas or B16F10 melanoma tumors, IMCs actively promoted endothelial cell migration into Matrigel plugs in vivo. Furthermore, placental IMCs, similar to tumor-derived IMCs, expressed matrix metalloproteinase-9 and Bv8, 2 pivotal proangiogenic proteins.
Conclusion
IMCs that express matrix metalloproteinase-9 and Bv8 infiltrate placentas of pregnant mice and actively promote angiogenesis. These cells show striking similarity to IMCs that populate malignant tumors.
CD11b + Gr1 + cells are a heterogeneous population of bone marrow–derived cells (BMDC) that consist of immature myeloid cells (IMCs), and were first described as myeloid-derived suppressor cells. In healthy individuals, IMCs that are generated in the bone marrow differentiate into mature granulocytes, macrophages, or dendritic cells. In contrast, under pathological conditions, such as cancer, a partial block in the differentiation of IMCs into mature myeloid cells results in the expansion of this population. The IMCs/myeloid-derived suppressor cells can be found in the bone marrow, spleen, and tumor sites and have been identified in most cancer patients and in experimental mice with tumors based on their ability to suppress T-cell activation. In the mouse, IMCs are identified by expression of cell surface markers detected by antibodies to CD11b, a myeloid lineage marker, and Gr1, detecting macrophage (Ly6C) and neutrophil (Ly6G) markers. Importantly, IMCs have been shown to actively promote tumor growth and metastasis by modulating the cytokine environment, and through vascular remodeling by promoting angiogenesis through increasing vascular density, vascular maturation, and decreasing necrosis within the tumor. Consistent with their proangiogenic function, they also mediate the refractory nature of many tumors to antivascular endothelial growth factor (VEGF) treatment. It is not clear, however, if and to what extent the immune tolerance and proangiogenic properties of IMCs are linked.
Many of the proliferative, invasive, and immune tolerance mechanisms that are used to support normal pregnancies have been shown to be similarly exploited by tumors to establish a nutrient supply and to evade immune surveillance. We thus hypothesized that angiogenesis within the placenta might be supported by IMCs in analogy to their function in malignancies. The goal of our study was to test for the presence of CD11b + Gr1 + IMCs in mouse placentas, and whether they share similar proangiogenic properties as those found in tumors. Exploring the immune function of placental IMCs was beyond the scope of the present study.
Materials and Methods
Experimental model
Animal studies were carried out using 6- to 8-week-old female mice. C57Bl/6J mice were purchased from Harlan Laboratories (Jerusalem, Israel). Pregnancies were dated according to vaginal plug appearance at morning inspection. Mice were sacrificed at the indicated stage, and the uterine horns were exposed by midline laparotomy. Placentas were carefully dissected from the decidual tissue and used for further analysis. For tumor experiments, B16F10 melanoma cells or Lewis lung carcinoma cells (ATCC) were maintained in Dulbecco modified Eagle medium (Invitrogen, Auckland, NZ) supplemented with 10% fetal bovine serum (Invitrogen). Cells were harvested from subconfluent cultures and injected subcutaneously, 2 × 10 6 cells in 0.2 mL phosphate-buffered saline (PBS). Mice were sacrificed and tumors were removed when they reached a size of ∼100 mm 3 . All animal procedures were performed in compliance with Weizmann Institute of Science guidelines and protocols approved by the Institutional Animal Care and Use Committee.
Flow cytometry
Tumor, placenta, and Matrigel specimens were digested with an enzyme mixture including: 25 μg/mL hyaluronidase (MP Biomedical, Solon, OH), 25 μg/mL DNaseI (Sigma-Aldrich, St Louis, MO), and 1 mg/mL collagenase type IV (Sigma) dissolved in PBS, at 37°C for 30 minutes. Digested tissue was then filtered through a 40 μm cell strainer and resuspended in fluorescence-activated cell sorting (FACS) buffer (PBS, 5 mmol/L EDTA, 1% bovine serum albumin [BSA], and 0.05% sodium azide). Immunostaining was performed in the presence of rat antimouse Fc receptor III/II (FcgammaRIII/II) (CD16/32, Pharmingen, San Diego, CA) by incubating the cells with monoclonal antibodies for 30 minutes on ice. Staining reagents included fluorochrome (allophycocyanin [APC], phycoerythrin [PE], or fluorescein-isothiocyanate [FITC]) labeled anti-CD11b, CD45, CD31, Gr1, Dx5, CD11c, all purchased from BD Biosciences, San Diego, CA. Flow cytometry was performed with a FACS Calibur (Becton Dickinson, Mountain View, CA). Flow cytometry based cell sorting was performed using FACS Aria (Becton Dickinson).
Matrigel plug assay
To directly analyze neovascularization in vivo, equal concentrations of CD45 + CD11b + Gr1 + IMCs and control BMDCs (CD45 + CD11b – Gr1 – ) were mixed with liquid Matrigel (BD Biosciences, Bedford, MA) and implanted subcutaneously in C57Bl/6J mice. After 8 days, animals were sacrificed; Matrigel plugs were removed, subjected to enzymatic digestion, and the percentage of infiltrating endothelial cells (ECs) was measured by flow cytometry.
Confocal microscopy
Frozen sections (12 μm) of placental tissue were fixed with acetone (–20°C), washed in PBS, and blocked with 20% horse serum in PBS. After immunostaining with primary antibodies anti-CD11b, anti-Gr1 (BD Biosciences), and anti-platelet endothelial cell adhesion molecule 1 (PECAM1) (eBioscience, San Diego, CA) followed by secondary antibodies, mounting was performed on glass slides with Vectashield HardSet Mounting Media with 4′,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA). Optical sections were scanned using a Zeiss LSM 510 Meta Duoscan confocal system (Carl Zeiss, Jena, Gemany).
Reverse transcriptase (RT)-polymerase chain reaction
Total RNA was extracted from sorted cells using Trizol (Invitrogen Life Technologies, Burlington, Ontario, Canada). Total RNA was reverse transcribed using the SuperScript II reverse transcriptase kit (Invitrogen). The resulting complementary DNA (cDNA) was subjected to polymerase chain reaction using SuperTherm polymerase (Hoffman-La-Roche, Basel, Switzerland). The following primers were used: matrix metalloproteinase (MMP)-9 Forward: TTGAGTCCGGCAGACAATCC, Reverse: CCTTATCCACGCGAATGACG; Bv8 Forward: ACTGCTACTTCTGCTGCTAC, Reverse: TGAGACTCGACGGACATTGT; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) Forward: GTTCCAGTATGACTCCACTC, Reverse: CAACCTGGTCCTCAGTGTA; beta-actin Forward: GATGACGATATCGCTGCGCTG, Reverse: GTACGACCAGAGGCATACAGG.
Statistical analysis
Statistical analysis was performed using paired 2-tailed Student t tests.
Results
We first sought to determine whether mouse placentas are populated by IMCs. Placental single-cell suspensions were stained with fluorescent-conjugated antibodies and analyzed by flow cytometry. CD45 + CD11b + Gr1 + IMCs ( Figure 1 , A) comprised 20-30% of total placental BMDC (CD45 + ) with a peak infiltration at midpregnancy ( Figure 1 , B). The BMDC in the adjacent decidua contained only ∼3% IMCs ( Figure 1 , A).
To further characterize the nature of the CD11b + Gr1 + population, placenta and spleen cells from pregnant mice were sorted using flow cytometry and collected onto glass slides. Analysis revealed a repertoire of differentiating cells of the myeloid lineage, including myeloblasts, promyelocytes (0.5%), myelocytes, metamyelocytes (67.5%), neutrophils (22%), and monocytes (10%) ( Figure 1 , C).
We next analyzed the CD45 + BMDC population that infiltrates the placenta, and compared it to the same population derived from B16F10 melanoma tumors. Intriguingly, both placenta and tumor tissues showed similar abundance of CD45 + CD11b + Gr1 + IMCs ( Figure 1 , D).
To determine the location of IMCs within the placenta, we stained frozen placental sections with fluorescent-conjugated antibodies and examined them by confocal microscopy. IMCs expressing both CD11b and Gr1 were localized adjacent to ECs (identified by the expression of PECAM1), consistent with involvement of these cells in angiogenesis ( Figure 2 ).
