Objective
Microbial invasion of the amniotic cavity is associated with spontaneous preterm labor and adverse pregnancy outcome, and Mycoplasma hominis often is present. However, the pathogenic process by which M hominis invades the amniotic cavity and gestational tissues, often resulting in chorioamnionitis and preterm birth, remains unknown. We hypothesized that strains of M hominis vary genetically with regards to their potential to invade and colonize the amniotic cavity and placenta.
Study Design
We sequenced the entire genomes of 2 amniotic fluid isolates and a placental isolate of M hominis from pregnancies that resulted in preterm births and compared them with the previously sequenced genome of the type strain PG21. We identified genes that were specific to the amniotic fluid/placental isolates. We then determined the microbial burden and the presence of these genes in another set of subjects from whom samples of amniotic fluid had been collected and were positive for M hominis.
Results
We identified 2 genes that encode surface-located membrane proteins (Lmp1 and Lmp-like) in the sequenced amniotic fluid/placental isolates that were truncated severely in PG21. We also identified, for the first time, a microbial gene of unknown function that is referred to in this study as gene of interest C that was associated significantly with bacterial burden in amniotic fluid and the risk of preterm delivery in patients with preterm labor.
Conclusion
A gene in M hominis was identified that is associated significantly with colonization and/or infection of the upper reproductive tract during pregnancy and with preterm birth.
Mycoplasma hominis is a common vaginal inhabitant that is associated with bacterial vaginosis (BV). The bacterium is considered harmless for the most part in nonpregnant women but can cause intraamniotic infections, which are associated with inflammation, preterm premature rupture of membranes, and preterm birth. A cohort study that involved >10,000 pregnant women found that women with BV had an increased risk for preterm birth; among women with BV, those who were colonized with both bacteroides and M hominis had the greatest increase in risk. More recent studies that have used 16S surveys to assess vaginal and intrauterine bacteria support the association between preterm birth and BV and/or M hominis .
One of every 3 preterm births is associated with microbial invasion of the amniotic cavity (MIAC). Intraamniotic infections can lead to inflammation, which triggers spontaneous preterm labor. Therapeutic intervention for intraamniotic infection is being studied, but treatment is currently largely unsuccessful. Intraamniotic infection is particularly common in births that occur at <32 completed weeks of gestation. This observation is significant because morbidity and death increase with decreasing gestational age at delivery. M hominis frequently is isolated from infected fetal membranes and amniotic fluid, and genital mycoplasmas (including Ureaplasma spp ) are isolated from umbilical cord blood in approximately 20% of very preterm (<32 weeks of gestation) newborn infants. However, the cause and pathogenesis of infectious preterm birth remain poorly understood. Bacteria likely invade the amniotic cavity by ascending from the vagina through the cervix or through hematogenous spread from more remote sources such as the oral cavity. Although microbial invasion of the amniotic cavity by M hominis is associated clearly with preterm birth, the reported relative risk that is associated with vaginal colonization varies widely in the literature, and the association is not strong enough or sufficiently consistent to render vaginal colonization as a predictor for poor pregnancy outcome. This and the lack of a strong association between other vaginal colonizers and preterm birth have hindered the early prediction of risk and effective medical intervention. However, a very recent study found that treatment of genital mycoplasmas late in pregnancy improves pregnancy outcome.
Closely related bacterial taxa can vary widely with respect to their gene content, even within a single species. With the advent of next-generation sequencing and the increasing speed and ease with which whole bacterial genomes can be sequenced has come the ability to observe the gain, loss, and modification of genes and evidence of the evolution of pathogens from nonpathogenic predecessors. For example, uropathogenic Escherichia coli differ from commensal gastrointestinal E coli strains in that they harbor adhesins that facilitate adherence to urinary epithelial cells, secreted toxins, and iron-acquisition systems that promote survival in the iron-limited environment of the urinary tract. Recently, Whidbey et al found that a nonsense mutation in a negative regulator of the hemolytic ornithine rhamnolipid pigment of Group B Streptococcus (GBS) led to increased hemolysis, cytotoxicity, and penetration of fetal membranes. In the same study, they also found that most GBS isolates from amniotic fluid and chorioamnion from women in preterm labor were hyperhemolytic and contained mutations in this regulator that suggest a genetic basis for the ability to cause ascending infection and preterm birth. These findings support the existence of genotypically distinct strains of bacterial species that possess virulence factor genes that increase their potential to cause infection or to infect a particular niche. We hypothesized that, similarly, distinct strains of M hominis that have increased genetic potential to invade the amniotic cavity exist and that identification of the genetic determinants that are involved in this heightened virulence could advance preterm risk assessment that is associated with vaginal colonization and lead to a better understanding of the pathogenesis of ascending M hominis infections. To test this hypothesis, we sequenced the genomes of M hominis amniotic fluid/placental isolates from 3 pregnant women who had episodes of spontaneous preterm labor that resulted in preterm delivery and compared their genomes to the only previously sequenced and publicly available complete genome of strain PG21 (ATCC 23114), a rectal isolate from a healthy individual.
Materials and Methods
Amniotic fluid and placenta isolates
Three M hominis amniotic fluid/placental isolates from pregnancies that resulted in preterm birth were collected as part of a previous study from 1991-1996. Two of the isolates were from amniotic fluid (AF1, AF3), and 1 isolate was from placenta (PL5). Gestational ages at delivery are listed in Table 1 . The isolates were cultured in modified arginine broth or on arginine agar (mycoplasma broth or agar that contained 0.5% arginine, 20% horse serum, 2.5% yeast extract [Oxoid, Hampshire, UK], and 150 μg ampicillin/mL) stationary at 37°C in air supplemented with 5% CO 2 .
| Feature | PG21 a | AF1 b | AF3 b | PL5 b |
|---|---|---|---|---|
| Reference | Pereyre | |||
| Body site | Rectum | Amniotic fluid | Amniotic fluid | Placenta |
| Gestational age at delivery, wk | N/A | 31 | 28 | 33 |
| Genome size, base pair | 665,445 | 704,093 | 680,135 | 721,886 |
| Guanine/cytosine content, c % | 27.1 | 27.2 | 27.2 | 27.2 |
| Protein encoding genes, n | 537 | 581 | 576 | 627 |
| Transfer RNA genes, n | 33 | 33 | 33 | 33 |
a Also known as ATCC 23114; a control that was isolated from the rectum of a healthy individual, not from a case of intraamniotic infection
b Isolated from intraamniotic infections in pregnancies in which episodes of spontaneous preterm labor resulted in preterm births
c Percent of the nucleotides in the whole genome that are either guanines or cytosines.
Preparation of sequencing libraries
Bacteria were grown in 50 mL arginine broth and collected by centrifugation; DNA was isolated with the Genomic-tip 500/G (Qiagen, Valencia, CA) according to manufacturer’s instructions. Genome sequencing was performed with pyrosequencing technology (Roche 454; 454 Life Sciences, Branford, CT), with a combined strategy of whole genome shotgun and 8-kilobase pair paired-end reads as previously described.
Genome assembly
Roche’s Newbler assembly software (454 Life Sciences) was used to perform de novo genome assemblies, with 454-FLX sequence data. The contigs were ordered by alignment to the reference genome of strain PG21 (Accession: PRJNA41875) using Mauve (Genome Evolution Laboratory, University of Wisconsin-Madison, WI). The genome of AF1 was closed by polymerase chain reaction (PCR) and Sanger sequencing.
Gene calling and analysis
RAST (Rapid Annotation using Subsystems Technology) was used to annotate the AF1, AF3, PL5, and PG21 genomes and to compare the genes and identify genes specific to ≥1 strains. OrthoMCL (Eukaryotic Pathogen Database Resources) was also used to identify unique genes. Absence of these genes in PG21 was confirmed by the tBLASTn database (National Center for Biotechnology Information [NCBI], Bethesda, MD). The circular chromosomes were visualized and compared with the BLAST Ring Image Generator (BRIG). Amino acid sequences of surface proteins were compared with the use of Geneious software (version 7.1.5; Biomatters Inc, San Francisco, CA).
Vaginal microbiome samples
Participants were recruited from outpatient clinics at the Virginia Commonwealth University Medical Center and the Virginia Department of Health after written, informed consent was obtained from 2009-2013. Inclusion criteria included women 18-44 years old who were able to provide informed consent and who were willing or already scheduled to undergo a vaginal examination with a speculum. The Institutional Review Boards for Human Subjects Research at Virginia Commonwealth University and the Virginia Department of Health reviewed and approved this study. Participants filled out a detailed questionnaire that included questions about ethnicity, education, employment, health habits, dietary habits, and sexual history. Clinicians used polyurethane foam swabs (CultureSwab EZ; Becton, Dickson and Company, Franklin Lakes, NJ) to obtain specimens from the mid-vaginal wall during a speculum examination. DNA was extracted from the swabs within 4 hours of collection with the Powersoil kit (MO BIO Laboratories Inc, Carlsbad, CA). The swabs were swirled directly in the Powerbead tubes (MO BIO Laboratories Inc) supplied with the kit; processing was according to manufacturer’s instructions. The 16S primers contain the A or B titanium sequencing adapter (shown in italics below), followed immediately by a unique variable (6-9 base) barcode sequence and finally the 5′ end of primer. The forward primer was a mixture (4:1) of the primers Fwd-P1 (5′ – CCATCTCATCCCTGCGTGTCTCCGACTCAG BBBBBB AGAGTTYGATYMTGGCTYAG) and Fwd-P2 (5′ – CCATCTCATCCCTGCGTGTCTCCGACTCAG BBBBBB AGARTTTGATCYTGGTTCAG). The reverse primer was Rev1B (5′ – CCTATCCCCTGTGTGCCTTGGCAGTCTCAG ATTACCGCGGCTGCTGG). PCR products were sequenced with the Roche 454 GS FLX Titanium platform (454 Life Sciences, Branford, CT). These data were generated as part of the Vaginal Human Microbiome Project. Raw sequence data from the project is available from the Short Read Archive at NCBI (projectID phs000256). We used a deep-sequencing approach with a median 24,030 reads/sample. All processed samples were represented by >5000 reads. Sequences were classified with a local installation of the RDP (NCBI) classifier (0.8 cutoff) and the STIRRUPS analysis platform. All samples for which gestational age at delivery was known that contained M hominis reads were used in this study.
Detection of genes specific to sequenced amniotic fluid/placental isolates
A portion of an overnight culture of AF1 was diluted serially and plated for enumeration. Another portion of the same culture was reserved for DNA extraction with the Powersoil kit. This DNA standard was used to quantify the amount of DNA amplified in real-time PCR assays. Primers for the 16S gene (5′-ATGAGGGTGCGGAACATTAG-3′, 5′-TAATTCCGGATAACGCTTGC-3′), arl (5′-CTGGCGGAAATTCACTAAGC-3′, 5′-ATCGCATCAAACATCGTGTC-3′), goiB (5′-CGCCAAAACTATGCACGCATTTAT-3′, 5′-GGTTAGCCTTTGGCCTCATAGTA-3′), and goiC (5′-CCTTACGGATATATGGTTGTTTCG-3′, 5′-CTAACTTAAATCATCAAGAGTACGG-3′) were validated for efficiencies between 97-100%. Quantitative real-time PCR was performed with the use of iTaq Universal SYBR Green Supermix and an iQ thermal cycler (Bio-Rad Laboratories, Hercules, CA).
Statistical analyses
Read counts were converted to proportions for all samples. Alpha diversity was measured with the inverse Simpson’s index. Differences in diversity between groups of samples were tested with a 2-sided t -test. Effect sizes of bacterial species that correlate with ethnicity were created with Linear discriminant analysis Effect Size (LEfSe). LEfSe uses the Kruskal-Wallis rank sum test to detect taxa that distinguish groups of subjects and uses linear discriminant analysis to calculate a linear discriminant analysis score for the effect size as described.
Results
Genetic differences in M hominis strains associated with intraamniotic infection
We sequenced the genomes of 3 M hominis amniotic fluid/placental isolates from pregnancies with episodes of spontaneous preterm labor that resulted in preterm births. Isolates AF1 and AF3 were from amniotic fluid, and PL5 was from placenta. The AF1 genome was finished and circularized (accession number: CP009677); AF3 (accession number: JRWZ00000000) and PL5 (accession number: JRXA00000000) were assembled into 12 and 10 contigs, respectively. Features of the genomes are shown in Table 1 . The genomes of all 3 amniotic fluid/placental isolates were slightly larger than the PG21 genome. The largest, from PL5, contained approximately 722 kb and 627 open reading frames. The average nucleotide identifies among the 3 amniotic fluid/placental isolates, and PG21 ranged from 98.1–98.6%. The percentages of guanine and cytosine nucleotides, which is a variable that is used in bacterial systematics to classify taxa, was similar for the genomes of all 4 strains.
Mobile genetic elements
Virulence and antibiotic resistance determinants often are transferred between bacterial strains within mobile elements such as pathogenicity islands, transposons and phages. The PG21 genome does not appear to contain any transposons or prophages. Strain AF3 apparently lacks phage genes as well. However, strains AF1 and PL5 each harbor a distinct mobile element. A putative prophage in AF1 is 15.2 kb and exhibits similarity to the M fermentans phiMFV1 prophage. A putative 26.6 kb mobile element in PL5 shares 96% identity with a transposon from Streptococcus agalactiae and other streptococci and enterococci. It contains 18 genes that include several predicted to encode proteins involved in the assembly of a conjugative pilus and conjugative transfer, a TetM tetracycline resistance protein, and 6 genes that are predicted to function in drug efflux or transport. We tested the minimum inhibitory concentrations of tetracycline for all 4 strains and found that the MIC for PL5 was 5 μg/mL, whereas the minimum inhibitory concentrations for AF1 was 0.08 μg/mL, and AF3 and PG21 were 0.16 μg/mL, which suggests that the TetM protein is active in PL5.
Variations in adhesins and virulence factors
PG21 aggregated and adhered to the culture vessel wall in liquid culture, whereas the cultures of the amniotic fluid/placental isolates were turbid and homogeneous. Adherence to the culture tubes was visualized by low-power microscopy ( Figure 1 ). The variable surface protein Lmp1 appears to play a role in the suppression of autoaggregation in M hominis . We therefore examined the major surface lipoproteins including Vaa, the variable membrane protein (Vmp), the Lmp proteins, P120, and P75 to determine whether genetic differences could explain the differential phenotype.
The Vmp loci of the 4 strains are illustrated in Figure 2 , A. As indicated in Figure 2 , B, the Vaa protein encoded by AF3 and PG21 shared high identities and similarities (93% and 95%, respectively), whereas Vaa in PL5 was shorter and exhibited lower identities and similarities with PG21 (57% and 73%). The length of Vaa in AF1 was similar to PL5; the identities and similarities with the protein from this strain were 79% and 87%, and it exhibited low identities and similarities with PG21 (57% and 71%). AF1 and PL5 each encoded 2 copies of vmp , whereas AF3 and PG21 lacked vmp ( Figure 2 ). In sum, the Vaa loci of the amniotic fluid isolates were not more similar to 1 another than they were to PG21.
All 3 amniotic fluid/placental isolates encoded Lmp1 proteins (AF1_245, AF3_439, and PL5_1) that were severely truncated (537 amino acid vs 1,522 amino acids) with respect to Lmp1 in PG21 (MHO_0530). All 3 amniotic fluid/placental strains encoded a 668 amino acid Lmp-like protein (AF1_409, AF3_259, and PL5_148) that was truncated at 482 amino acids in PG21 (MHO_4280). The Lmp3 proteins encoded by the 3 amniotic fluid/placental isolates and PG21 varied in size. The P120 proteins encoded within PG21 (MHO_3660) and PL5 (PL5_410) shared 99% identities, whereas AF3_321 shared only 84% identities with PL5_410 and MHO_3660. The P75 proteins of AF3 (AF3_315) and PL5 (PL5_416) shared higher identities with PG21 (MHO_3720; 91% and 96%, respectively) than with each other (89%). In sum, the amniotic fluid/placental isolates encoded similar truncated Lmp1 proteins and similar Lmp-like proteins, but the remaining surface-associated proteins were not more similar among the amniotic fluid/placental isolates vs PG21.
Genes exclusive to M hominis strains associated with intraamniotic infection
Figure 3 depicts the AF1 chromosome as the benchmark to which the AF3, PL5, and PG21 were compared with the use of the analysis tool BRIG to facilitate identification of genes that were present in the amniotic fluid/placental isolates, but absent in PG21. Genes present in the amniotic fluid/placental isolates, but absent in PG21, were visualized as gaps restricted to the PG21 chromosome. Overall, there are relatively few gaps in the chromosome that suggest that all 4 strains generally bear a similar complement of highly related genes. All 3 amniotic fluid/placental isolates contain 3 genes that are absent in PG21, so we investigated these 3 genes further.
One of the genes that was in the amniotic fluid/placental isolates and absent in PG21 appears to encode alanine racemase (designated for the purposes of this study as alr ). Alanine racemase converts L-alanine to D-alanine, a component of peptidoglycan. Mycoplasmas lack peptidoglycan, but some species do encode alanine racemase. The function of this enzyme in mycoplasmas is unknown.
The second gene encodes a 379 amino acid protein (AF1_212, AF3_405, PL5_34) of unknown function (designated for the purposes of this study as gene of interest B [ goiB ]). The protein encoded by goiB aligns over 97% of its length to a hypothetical protein from Ureaplasma urealyticum (41% identity and 63% similarity). This protein appears to have a signal peptide and is predicted by the PSORTb bacterial subcellular localization prediction tool (Brinkman Laboratory, Simon Fraser University, British Columbia, Canada) to be secreted. It was analyzed with the use of Phyre2 (Structural Bioinformatics Group, Imperial College, London, UK), which modeled 46% of the amino acid residues with >90% confidence; the closest structural match was a putative c39-like peptidase (96.2% confidence). Therefore, the gene could encode a secreted protease. There are no predicted secreted proteases annotated in the PG21 genome.
The third gene (AF1_518, AF3_365, PL5_294) encodes a protein that is not similar to any proteins of known function (designated for the purposes of this study as gene of interest C [ goiC ]). The region surrounding this gene is similar in strains AF1 and AF3, but portions of the region are absent in PL5 and PG21 ( Figure 4 ). The amniotic fluid/placental isolates also contain multiple direct repeats in this region. All 3 amniotic fluid/placental strains exhibit 547 nt and 1884 nt repeats; AF1 and AF3 also contain a 246 nt repeat and 3 additional DNA methyltransferase genes. The variable region is flanked by a conserved HAD hydrolase (MHO_3310 in PG21) and an ABC transporter (MHO_3250).
All of the genes that were unique to ≥1 amniotic fluid/placental isolates are listed in Table 2 . We also analyzed and compared the lengths of all genes within each strain to facilitate the detection of truncations that might result in a loss of protein function. Aside from the membrane protein-encoding genes, we did not detect any genes that were truncated in all 3 amniotic fluid/placental strains. However, there were 4 genes that encoded longer proteins in the amniotic fluid/placental strains than in PG21, which suggests possible loss of function of these proteins in PG21. Two of these were annotated by RAST as hypothetical proteins, and 2 likely are involved in transport ( Table 2 ).
| Gene identifier a | Putative function | Additional information |
|---|---|---|
| AF3_360 | Type II restriction enzyme | |
| PL5_435 | Variable membrane protein | |
| AF1_110, AF3_18 | Type II restriction enzyme | |
| AF1_210, AF3_363 | Type II restriction enzyme | |
| AF1_231, PL5_326 | Variable membrane protein | |
| AF1_511-AF1_517, AF3_358-AF3_364 | Hypothetical proteins | Not present in PL5 |
| AF1_23, AF3_18, PL5_476 | Alanine racemase | Amniotic fluid/placental isolate gene A ( alr ) b |
| AF1_212, AF3_405, PL5_34 | Hypothetical protein from Ureaplasma urealyticum (low similarity). | Amniotic fluid/placental isolate gene B ( goiB ) b |
| AF1_518, AF3_365, PL5_284 | Hypothetical protein | Amniotic fluid/placental isolate gene C ( goiC ) b |
| AF1_135, AF3_121, PL5_112, MHO_1580 | Hypothetical protein | Present in PG21 but truncated because of nonsense mutation |
| AF1_330, AF3_184, PL5_343 | Cation-transporting ATPase, E1-E2 family | Present in PG21 but truncated because of nonsense mutation (not annotated) |
| AF1_401, AF3_251, PL5_156, MHO_4360 | ABC transporter ATP-binding protein | Present in PG21 but truncated because of nonsense mutation |
| AF1_248 AF3_442 PL5_555 | Hypothetical protein | Present in PG21 but truncated because of nonsense mutation (not annotated) |
a The strains harboring the gene are listed. Amino acid and nucleotide sequences corresponding to the gene identifiers can be found through NCBI (Accession numbers CP009677, JRWZ00000000, and JRXA00000000)
b The presence of these genes in vaginal swab samples and amniotic fluid samples was determined in this study.
Association of specific genes with preterm labor and delivery
We performed 16S gene surveys on DNA extracted from vaginal swab samples from 58 pregnant subjects, 10 of whom gave birth preterm and 48 of whom gave birth after ≥37 weeks’ gestation. Of the 58 subjects, 37 (64%) were self-reported African American; 8 were self-reported white (14%); 11 were self-reported Hispanic (19%), and 2 reported >1 ethnicity (3%). M hominis was detected in vaginal swabs of 17 of the subjects, 15 of whom were African American (88%) and 2 were Hispanic (12%). Of the 10 preterm births, 4 were positive for M hominis ; of the 48 full-term births, 13 were positive for M hominis . There was no significant difference in the frequency of detection of M hominis and preterm birth (Fisher exact test, P = .46).
We analyzed DNA extracted from the 17 samples that contained M hominis by quantitative PCR using 16S ribosomal RNA gene-specific primers to determine the approximate numbers of M hominis present per milliliter of vaginal fluid. We also analyzed the samples for the presence of alr , goiB , and goiC ( Table 3 ). Two of the 4 preterm samples and 5 of the 13 full-term vaginal samples contained alr , but the presence of this gene was not associated with preterm birth (Fisher exact test, P = 1). PCR revealed that 3 of the 4 M hominis –positive samples from preterm deliveries contained goiB , whereas 6 of 13 of the full-term pregnancies contained the gene; but this association did not reach statistical significance (Fisher exact test, P > .05). Interestingly, PCR revealed that 4 of the 4 samples from preterm pregnancies with M hominis contained goiC , whereas only 4 of 13 of the samples from full-term pregnancies contained the gene. Accordingly, there was a statistically significant association between the presence of the gene in the vaginal samples and preterm birth (Fisher exact test, P < .05).
| Vaginal sample | Gestational age at delivery a | Ethnicity b | Age, y c | Rupture d | Colony-forming units/milliliter ± SD e | alr f | goiB f | goiC f |
|---|---|---|---|---|---|---|---|---|
| 1 | 34 | AA | 36 | No | 10,608 ± 722 | – | + | + |
| 2 | 34 | AA | 23 | No | 308,247 ± 49,687 | + | + | + |
| 3 | 34.2 | AA | 24 | Yes | 439,288 ± 17,654 | + | – | + |
| 4 | 35.4 | AA | 23 | ND | 2,637,620 ± 309,422 | – | + | + |
| 5 | 38 | AA | 26 | No | 85,841 ± 16662 | – | + | – |
| 6 | 38.2 | AA | 36 | No | 32,114 ± 720 | + | + | + |
| 10 | 38.5 | AA | 22 | No | 2153 ± 128 | – | – | – |
| 7 | 39.0 | His | 26 | No | 151,221 ± 29,232 | – | – | – |
| 8 | 39.1 | His | 26 | No | 1867 ± 261 | – | – | – |
| 9 | 39.2 | AA | 28 | No | 1232 ± 198 | + | – | – |
| 11 | 39.3 | AA | 41 | No | 527 ± 26 | + | – | – |
| 12 | 39.3 | AA | 21 | No | 1726 ± 129 | – | – | – |
| 13 | 39.6 | AA | 19 | No | 310 ± 54 | + | + | + |
| 14 | 39.6 | AA | 23 | No | 981 ± 142 | – | + | – |
| 15 | 40.5 | AA | 21 | No | 3950 ± 341 | + | + | + |
| 16 | 41 | AA | 26 | Yes | 64,711 ± 6053 | – | – | + |
| 17 | 41 | AA | 26 | Yes | 32,595 ± 1924 | – | + | – |
a Gestational age at delivery (weeks.days)
b Self-reported maternal ethnicity
d Ruptured membranes noted at time of sampling
e Estimated number of M hominis per milliliter of vaginal fluid as determined by 16S ribosomal RNA gene quantitative polymerase chain reaction (standard deviation)
f Presence (+) or absence (–) of the amniotic fluid/placental isolate genes A, B, or C ( alr , goiB , goiC ) as determined by real-time polymerase chain reaction.
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
