Objective
We sought to investigate maternal and child functional MDR1 C3435T polymorphism, periconception medication, folic acid use, and the risk of a congenital heart defect (CHD) in the offspring.
Study Design
MDR1 3435C>T genotyping was performed in 283 case triads (mother, father, child) and 308 control triads. Information on periconception medication and folic acid use was obtained through questionnaires.
Results
Mothers with MDR1 3435CT/TT genotype and using medication showed a significant association with the risk of a child with CHD (odds ratio [OR], 2.4; 95% confidence interval [CI], 1.3–4.3) compared to mothers with MDR1 3435CC genotype not using medication. This risk increased without folic acid use (OR, 2.8; 95% CI, 1.2–6.4), and decreased in folic acid users (OR, 1.7; 95% CI, 0.8–3.7). Children carrying the MDR1 3435CT/TT genotype and periconceptionally exposed to medication without folic acid did not show significant risks.
Conclusion
Mothers carrying the MDR1 3435T allele, using medication without folic acid, are at nearly 3-fold increased risk for CHD in the offspring.
Worldwide around 1 million children are born every year with a congenital heart defect (CHD), which not only is the most frequent class of birth defects but also the leading cause of infant morbidity in the Western world. The etiology of CHD is complex and believed to result from complex interactions between subtle genetic variations and periconception environmental exposures. As the mother serves as the environment of the developing child in utero, maternal disease and harmful lifestyles in conjunction with genetic susceptibilities can modulate the risk of CHD. It is known that maternal medication use can exert teratogenic effects, and several medications have been linked to CHD, such as antihypertensives and anticonvulsants.
Several transporters are responsible for an adequate efflux of medication and other toxins from the circulation. Of special interest are the ABC transporters, particularly ABCB1 or P-glycoprotein (P-gp), encoded by the MDR1 gene. Studies in MDR1 knockout mice demonstrated that P-gp deficiency enhances the susceptibility to chemically induced birth defects. The 3435C>T synonymous single nucleotide polymorphism in MDR1 is associated with an increased degradation of MDR1 messenger RNA (mRNA) and, consequently, decreased P-gp expression. This polymorphism may thus modify cellular exposures to several compounds. A recent in vitro study showed that the cellular folate concentration also determines the function of the MDR1 transporter; a folate-rich environment increases the efflux of MDR1 substrates from the cell. Therefore, carriership of the MDR1 3435C>T polymorphism in the mother and/or the child might perturb the detoxification pathway. From this background we hypothesize that carriership of MDR1 3435C>T in combination with periconception maternal medication use increases the risk of CHD, in which folic acid in the periconception period acts as modifier. This hypothesis was investigated in a case-control family study of mother, father, and the child, in an ethnically homogeneous sample in the western part of The Netherlands.
Materials and Methods
Study population
This study is part of the HAVEN study, an ongoing case-control family study designed to investigate the role of genetic and lifestyle factors in the pathogenesis and prevention of CHDs. From June 2003 onward, we recruited cases from 4 university medical centers and randomly recruited controls in collaboration with the child health care centers of Thuiszorg Nieuwe Waterweg Noord in the Rotterdam area. Child health care centers are part of the Dutch Health Care system where physicians specializing in child health care regularly check all newborns at standardized moments on health, growth, and development. Case and control children were derived from the same domain population in the western part of The Netherlands. The materials and methods for this study have been described previously and are summarized below.
All children were aged 11-18 months and of European origin. To exclude strong genetic factors, no familial relationship existed between cases and controls.
The included CHD phenotypes (n = 283) were tetralogy of Fallot (n = 31), transposition of the great arteries (n = 49), atrioventricular septal defect (n = 28), perimembranous ventricular septal defect (n = 75), coarctation of the aorta (n = 28), aortic valve stenosis (n = 5), pulmonary valve stenosis (n = 52), and hypoplastic left heart syndrome (n = 15). This selection of CHD phenotypes was based on experimental and epidemiological studies that showed that hyperhomocysteinemia and related gene-environment interactions are involved in the etiology. All CHDs were diagnosed by 2 pediatric cardiologists, both trained at the university medical center in Leiden, using echocardiography and/or cardiac catheterization and/or surgery data.
Control children (n = 308) had no major congenital malformations or chromosomal abnormalities according to the medical records and regular health checks by physicians of the child health centers.
The Central Committee on Research involving Human Subjects and the institutional review boards of all participating hospitals approved the study protocol. All parents gave their written informed consent also on behalf of their child before participation.
Data collection
At the time of study, approximately 16 months after delivery of the index child, data were obtained by a self-administered questionnaire on sociodemographic characteristics, such as age, ethnicity, educational level, and periconception use of medication and folic acid. During the hospital visit the questionnaire was checked by the researcher for completeness and consistency.
We defined the periconception period as 4 weeks before conception until 10 weeks after conception. The use of folic acid in the periconception period was defined as the daily use of at least 400 μg of folic acid, either in a multivitamin preparation or as a single tablet during the complete period. Mothers who used folic acid only during a part of the periconception period were classified as nonusers. A positive family history of CHD was defined as the child having a third-degree, or closer, relative with CHD. We categorized education level as low (primary/lower vocational/intermediate secondary), intermediate (higher secondary/intermediate vocational), or high (higher vocational/university) according to the Dutch classification.
We defined medication use as any use in the periconception period. We classified the medication according to the Anatomical Therapeutic Chemical classification. At the time of study, blood or buccal swabs were obtained to extract DNA from all children and their parents.
For the current study we selected case and control families from whom DNA was available from at least the mother, ie, case family: 257 children, 284 mothers, and 264 fathers; and control triads: 299 children, 309 mothers, and 292 fathers. Genotype data were checked for mendelian errors. Inconsistent families (1 case and 1 control) were excluded from analysis.
Blood sampling
DNA was isolated from EDTA blood with a total nucleic acid extraction kit on a MagNAPure LC (Roche Molecular Biochemicals, Mannheim, Germany). MDR1 3435C>T genotyping on case and control triads was done using a Taqman allelic discrimination assay on the ABI Prism 7000 HT Sequence detection system (Applied Biosystems [ABI], Nieuwerkerk a/d IJssel, The Netherlands). The assay consisted of 2 allele-specific minor groove binding probes designed by Applied Biosystems’ Assay-by-Design service; the probe sequence CCCTCACGATCTCTT was labeled with the fluorescent dye VIC and the probe sequence CCCTCACAATCTCTT with the fluorescent dye FAM. The primer sequence for the forward primer was ATGTATGTTGGCCTCCTTTGCT, and for the reverse primer GCCGGGTGGTGTCACA. The polymerase chain reaction was performed in a reaction volume of 10 μL, containing assay-specific primers, allele-specific Taqman minor groove binding probes, Abgene Absolute QPCR Rox Mix, and genomic DNA (1 ng). The thermal profile consists of an initial denaturation step at 95°C for 15 minutes, followed by 40 cycles of denaturation at 92°C for 15 seconds, and annealing and extension at 60°C for 1 minute. Genotypes were scored by measuring allele-specific fluorescence using the SDS 2.2.2 software (Applied Biosystems) for allelic discrimination.
Statistical analyses
Sociodemographic and lifestyle characteristics were compared between cases and controls using a χ 2 test for categorical variables and a Mann-Whitney U test for continuous variables. All continuous variables are presented as medians with interquartile range, because some of them were skewed even after transformation. Deviations from Hardy-Weinberg expectations were tested with a χ 2 test. The frequencies of the alleles were compared between cases and controls, and odds ratios (ORs) were calculated with 95% confidence intervals (CIs), using the C allele as the reference. To test the association between the MDR1 polymorphism and CHD risk, we used the Family Based Association Test (FBAT) software that looks for distortions in the transmission frequencies of a given allele, compared to the assumption of random transmission, and also incorporates control data. We used a dominant model combining the CT and TT genotypes based on the functional effect of the polymorphism. Univariate logistic regression analysis was used to compute ORs and 95% CIs for the association between case-control status and dichotomous variables MDR1 polymorphism, medicine and folic acid use. We coded separate categories for the risk of the genotype of mother or child in combination with periconception medication and folic acid use. The reference category was considered the lowest risk category: MDR1 CC carriers without periconception medication use and with the use of folic acid. The highest risk group consisted of MDR1 CT/TT carriers with periconception exposure to medication and no use of folic acid. In addition, we computed ORs with 95% CI in a multivariable logistic regression model adjusting for the genotype of either child or mother. The P values for trend were calculated across the different subgroups with a linear-by-linear association test. Probability values of P < .05 were considered statistically significant, all tests were 2-sided. Analyses were performed with software (SPSS for Windows, version 15.0; SPSS Inc, Chicago, IL) or FBAT 3.2. Stratified analyses of the different CHD phenotypes were not feasible due to the limited sample size limitations.
Results
Sociodemographic and lifestyle characteristics of mothers, fathers, and children are presented in Table 1 . Periconception medication use was the only significant difference between case and control mothers. Case mothers used overall more often medication (OR 1.5; 95% CI 1.0–2.1). According to the Anatomical Therapeutic Chemical classification, medication use comprised laxatives (A01 cases 0.4%), antacids (A02 cases 0.4% vs controls 0.3%), spasmolytics (A03 controls 0.3%), insulin (A10 cases 0.4% vs controls 0.6%), antihemorrhagics (B01 controls 0.3%), antithrombotic agents (B02 cases 0.4% vs controls 0.3%), antihypertensive drugs (C02 cases 0.4% vs controls 0.6%), beta blockers (C07 cases 0.8% vs controls 0.3%), prolactin inhibitors (G02 cases 0.7%), sex hormones and modulators of the genital system (G03 cases 3.2% vs 2.9%), thyreomimetics (H03 cases 1.8% vs 1.0%), systemic antibacterials (J01 cases 3.5% vs controls 3.2%), hormones and related agents (L02 cases 0.4%), prostaglandinesynthase blockers (M01 cases 2.1% vs controls 0.6%), analgesics (N02 cases 5.3% vs 4.5%), antiepileptics (N03 cases 0.4% vs controls 0.6%), psycholeptics (N05 cases 1.4%), psychoanaleptics (N06 cases 1.8% vs controls 1.6%), nasal preparations (R01 cases 0.4%), drugs for obstructive airway disease (R03 cases 2.8% vs controls 1.3%), cough and cold preparations (R05 cases 0.4% vs controls 0.3%), systemic antihistamines (R06 cases 5.3% vs controls 1.9%), unspecified antibiotics/mycotics (cases 0.4% vs controls 1.6%), and homeopathics (cases 0.7% vs controls 1.0%). Except for a higher percentage of systemic antihistamines (cases n = 15 vs controls n = 6; P = .028) and psycholeptics (cases n = 4 vs controls n = 0; P = .036) in case mothers, medication use was not significantly different from control mothers. Table 2 presents the allele and genotype frequencies and risk estimates for the MDR1 polymorphism for mothers, fathers, and children. The distribution of the T allele and genotypes were not significantly different among cases and control fathers and children. In contrast, more case mothers were carriers of the MDR1 TT/CT genotypes, which were significantly associated with an increased risk for CHD offspring (OR, 1.7; 95% CI, 1.1-2.5).
| Characteristic Mothers | Cases n = 283 | Control n = 308 | P value |
|---|---|---|---|
| Age at delivery index child, y a | 31.6 (28.9–34.8) | 31.4 (28.2–34.0) | .15 b |
| Educational level | .49 c | ||
| Low d | 57 (18.5) | 63 (22.3) | – |
| Intermediate d | 154 (50.0) | 131 (46.3) | – |
| High d | 97 (31.5) | 89 (31.4) | – |
| Periconception | |||
| Medication d | 83 (29.3) | 68 (22.1) | .04 c |
| Tobacco d | 53 (18.7) | 64 (20.8) | .53 c |
| Alcohol d | 121 (42.8) | 113 (36.7) | .15 c |
| Folic acid d , e | 152 (53.7) | 183 (59.4) | .16 c |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
