Objective
Sialidase and the presence of Gardnerella vaginalis have been proposed as biomarkers for bacterial vaginosis. Sialidase has been associated with adverse pregnancy outcome. We genotyped G vaginalis isolates, assessed the presence and diversity of sialidase-encoding genes, and determined the production of sialidase.
Study Design
One hundred thirty-four G vaginalis isolates were genotyped by random amplified polymorphic deoxyribonucleic acid (RAPD) and a selection of 29 isolates with amplified ribosomal deoxyribonucleic acid restriction analysis (ARDRA). A G vaginalis sialidase quantitative polymerase chain reaction was developed, and the sialidase production was assessed with the filter spot test.
Results
Three G vaginalis genotypes could be distinguished by both RAPD and ARDRA. Only 2 genotypes encoded and produced sialidase.
Conclusion
Three genotypes exist among G vaginalis isolates, and there is a clear link between genotype and sialidase production. A possible link between sialidase production and (symptomatic) bacterial vaginosis and biofilm production can be hypothesized.
The cervical mucus layer plays an important role as a barrier against colonization and infection of the vaginal and cervical epithelium by trapping pathogens and removing them from the female reproductive tract by mucin turnover. It has been demonstrated that sialidase, hexosaminidase, galactosidase, and prolidase activities of the vaginal microflora play an essential role in the sequential degradation of the mucus layer, suggesting a synergistic pact between different pathogens, equipped with different mucinases. The activities of these enzymes increase markedly in most subjects diagnosed as having bacterial vaginosis (BV). Sialidase in particular has been studied extensively regarding its link to BV and preterm birth (PTB).
The presence of certain bacterial species, such as Gardnerella vaginalis , has been considered as an indicator for BV and PTB. G vaginalis was found to be the most common BV-related microorganism, isolated from the chorioamnion of women in preterm labor, whereas others correlated the presence of Prevotella bivia (a strong sialidase producer) in vaginal fluid with an important increase in PTB. Taken together, the design and implementation of a typing scheme to identify strains of G vaginalis that are associated with preterm labor and other BV-associated complications could influence decisions regarding the potential benefits of therapeutic intervention.
G vaginalis is equipped with a variety of virulence factors including biofilm formation, prolidase, sialidase, β-galactosidase, and vaginolysin, although healthy women can be vaginally colonized. This raises the question whether there are pathogenic and commensal lineages within this species. Full genome sequencing of G vaginalis seems to indicate that indeed different lineages with different pathogenic potential exist. Efforts have been made to refine our insights into the pathogenesis of BV by dividing G vaginalis into genotypic and phenotypic groups. Phenotypically, based on enzymatic activities of β-galactosidase, lipase, and hippurate hydrolase, G vaginalis has been divided into 8 biotypes. Amplified ribosomal deoxyribonucleic acid (DNA) restriction analysis (ARDRA) proved useful in recognizing 3 different G vaginalis genotypes.
In this study, we detailed the presence and diversity of sialidase-encoding genes and the production of sialidase by different G vaginalis isolates, identified by means of transfer DNA (tDNA)-polymerase chain reaction (PCR) as described previously and genotyped this collection using random amplified polymorphic DNA (RAPD) analysis, ARDRA, and 16S ribosomal ribonucleic acid (rRNA) and sialidase gene sequencing.
Materials and Methods
Bacterial isolates
A total of 134 G vaginalis isolates from 3 different studies were used, 115 from 16 Belgian women and 19 from 10 Kenyan women (of which 8 were human immunodeficiency virus negative). Table 1 summarizes the data.
| Study (EC approval number) | Women, n | Isolates, n | Women with 1 genotype, n | Women with 2 genotypes, n | Women with 3 genotypes, n |
|---|---|---|---|---|---|
| Belgian longitudinal study of the VMF (IRB #EC UZG 2008/439) | 10 | 97 | 3 | 6 | 1 |
| Belgian probiotics study (IRB #EC UZG 2008/114) | 6 | 18 | 2 | 3 | 0 |
| Kenyan longitudinal study (IRB #P122/8/2005) | 10 | 19 | 9 | 1 | 0 |
| Total | 26 | 134 | 14 | 10 | 1 |
The isolates from species other than G vaginalis are listed in the Results section.
Grading of Gram-stained vaginal smears
Gram-stained vaginal smears were scored by 4 independent assessors according to the criteria previously described.
DNA extraction
DNA was extracted from cultured G vaginalis isolates by alkaline lysis, as described previously.
Identification of bacterial isolates
All bacterial isolates in this study were identified with tDNA-PCR, as described previously.
Genotyping with RAPD analysis
The G vaginalis isolates were genotyped using RAPD analysis with Ready-to-Go RAPD beads (GE Healthcare, Buckinghamshire, UK) with primer OPM1 (5′ GTTGGTGGCT) at a final concentration of 2 μM and a final concentration of 0.4 μM of fluorescent VIC-labeled OPM1 primer. After 5 minutes at 94°C, 5 minutes at 35°C, and 5 minutes at 72°C, reaction mixtures were cycled 30 times in a Veriti thermal cycler (Applied Biosystems, Foster City, CA), with the following conditions: 30 seconds at 94°C, 1 minute at 35°C, and 1 minute at 72°C, with a final extension period of 5 minutes at 72°C. The PCR product was subjected to capillary electrophoresis (ABI-Prism 3130XL genetic analyzer; Applied Biosystems), and the resulting DNA fingerprints were compared using the BaseHopper software (freely available at http://www.basehopper.be/ ).
Genotyping with ARDRA
ARDRA was used to check the results of the RAPD analysis. The 16S rRNA gene was amplified with the primers GV10F (5′ GGTTCGATTCTGGCTCAG) and ωMB (5′ TACCTTGTTACGACTTCGTCCCA), and the amplified rRNA gene was restriction digested with the TaqI restriction enzyme. Per 10 μL of 16S-PCR product, a mix of 4 μL 10× buffer TaqI , 2 μL TaqI polymerase (10 U/μL) (Fermentas, St Leon-Rot, Germany), and 4 μL of high-performance liquid chromatography-water were added. The restriction digest was performed overnight at 65°C. The reaction was inactivated with 0.8 μL 0.5 M EDTA (pH 8). Restriction patterns were analyzed by electrophoresis at 140 V (7 V/cm) for 2 hours on 1.5% MP agarose (Roche, Vilvoorde, Belgium) and 1.5% metaphor agarose (Cambrex Bio Science, Rockland, ME) gels, containing 10 μg/mL ethidium bromide, after visualization by ultraviolet (320 nm). A molecular weight marker was used (100 bp ladder; Fermentas).
Sialidase PCR
The sequence of sialidase A (NZ_ACGF02000001.1) from the fully sequenced G vaginalis ATCC 14019 strain (reference genome for the Human Microbiome Project, Baylor College of Medicine, Houston, TX) served as the template for designing the primer set for amplification of the sialidase gene from G vaginalis . Primer Blast (National Center for Biotechnology Information, Bethesda, MD) was used to design the following primer set: G vaginalis sialidase (GVSI) forward (5′ GACGACGGCGAATGGCACGA) and GVSI reverse (5′ AGTCGCACTCCGCGCAAGTC). Melting curve analysis of the G vaginalis sialidase amplicons was carried out after amplification with the quantitative PCR (qPCR) core kit for SYBR Green I (Eurogentec, Luik, Belgium) on the ABI 7000 real-time PCR system (Applied Biosystems).
Sialidase activity
The filter spot test was used for determining sialidase activity of cultured G vaginalis isolates. It was performed as described previously.
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
