Objective
We sought to investigate effects of intratracheal albumin injection prior to tracheal occlusion (TO) on lung proliferation in fetal rats with nitrofen-induced congenital diaphragmatic hernia.
Study Design
On embryonic day 19, nitrofen-exposed fetuses underwent TO, TO and 50 μL of either intratracheal albumin 20% or saline, or remained untouched. Main outcome at embryonic day 21.5 was expression of the proliferation marker Ki-67. Secondary outcomes were lung-to-bodyweight ratio (LBWR), tropoelastin expression, density and spatial distribution of elastin, pulmonary/alveolar morphometry, and fetal survival.
Results
TO increased Ki-67 messenger RNA and LBWR. Albumin further increased LBWR and density of Ki-67-positive cells but also fetal mortality. TO with or without adjuncts induced elastin deposits at the tips of arising secondary crests, increased air space size, and decreased septal thickness.
Conclusion
TO had effects on lung proliferation and advanced the morphologic appearance. Addition of albumin increased density of proliferating cells and LBWR, yet at the expense of additional fetal loss.
Congenital diaphragmatic hernia (CDH) occurs with an incidence of 1:2500–1:5000 newborns and causes pulmonary hypoplasia. Affected lungs are characterized by fewer alveoli with thickened walls, increased interstitial tissue, and reduced alveolar air space and gas-exchange surface area, accompanied by impaired vascular development. Those changes lead to ventilatory insufficiency and pulmonary hypertension in the neonatal period. The underlying etiology remains unclear. A current hypothesis, derived from studies using the nitrofen rat model, is that both lungs are already affected early in development by yet unknown genetic or environmental factors independently from a diaphragmatic defect (first hit); the defective development of the diaphragm then allows herniation of abdominal organs into the thoracic cavity, limiting pulmonary space ipsilateral to the defect and interfering with fetal breathing movements (second hit).
Normal lung growth and maturation are dependent on the presence of a distending force caused by continuous fetal lung liquid production, in combination with cyclic pressure changes induced by fetal breathing movements. This cyclic tissue stretch within the fetal airways induces the expression of specific genes that regulate lung growth and development. Reduced intrathoracic space and lack of amniotic fluid are notable factors impairing lung development, whereas airway obstruction, as in laryngeal atresia, triggers lung growth. Tracheal occlusion (TO) takes advantage of the latter observation: preventing egress of lung fluid, which is continuously produced by the airway epithelium, leads to additional stretch, triggering proliferation. Current insights into this process were recently elegantly reviewed by Nelson et al and Khan et al. In clinical trials, fetoscopic endoluminal TO is currently offered to selected fetuses with severe CDH. However, pulmonary response, as measured by imaging methods, is dependent on the preexisting lung size. In total, 43% of neonates do not survive despite fetoscopic endoluminal TO, typically those with the smallest preexisting lungs, or those with poor lung response as documented by lung volumetry or pathology studies. For those, additional or other strategies need to be developed. Therefore, the use of oncotic agents in combination with TO was suggested, as they might cause additional tissue stretch within the fetal airways, hence provoking a more vigorous lung response. However, those studies were conducted in fetal lambs with normally developing lungs. Several animal models have been used to study CDH, of which 1 is the nitrofen model. Nitrofen is a potent teratogen, which induces, next to other anomalies, diaphragmatic defects in rodents. In rats, left diaphragmatic defects can be induced by maternal oral administration of nitrofen around embryonic day (E)9 in almost one-half of the offspring. The feasibility of TO in fetal rats has also been demonstrated before.
Herein we aimed to investigate the effects of intratracheal albumin injection at the time of TO on lung proliferation in rat fetuses with nitrofen-induced diaphragmatic hernia.
Materials and Methods
Animal model and study design
The protocol was approved by the ethical committee on animal experimentation of the Katholieke Universiteit Leuven. Time-mated Wistar rats (Elevage Janvier, Le Genest Saint Isle, France) were gavage fed 100 mg of nitrofen (2,4-dichloro-1-4-nitrophenoxybenzene 97%; Maybridge Trevillett, Tintagel, UK) dissolved in 1 mL of olive oil on E9.5 (term E22).
On E19, maternal rats were anesthetized with isoflourane (Isoba; Schering-Plough Animal Health, Kenilworth, NJ) and laparotomy was performed to expose the bicornuate uterus. Every second fetus was randomly assigned to 1 of 3 intervention groups: (1) TO or (2) TO with prior intratracheal injection of either albumin (TO-Alb) or (3) saline (TO-Sal). All other fetuses from the same litter remained untouched and served as internal controls.
Fetal surgery was performed as earlier described by Maltais et al. Briefly, a purse-string suture (6-0 Prolene; Ethicon Inc, Somerville, NJ) was placed through the myometrium close to the fetal head. After hysterotomy and amniotomy, the fetal head was exteriorized to access the trachea, which was exposed by mid-line incision. TO was performed using microsurgical hemostatic clips (Horizon Microclip; Weck Closure Systems, Research Triangle Park, NC). For TO-Alb and TO-Sal, 50 μL of either 20% human albumin (Hibumine; Baxter Healthcare, Deerfield, IL) or 0.9% saline (sodium chloride, Viaflo; Baxter Healthcare) was injected via the trachea prior to occlusion, whereas the TO group did not undergo any injection. To allow injection, the fetal trachea was intubated with a blunt curved needle by advancing it under microscopic control (OPMI 6; Carl Zeiss, Oberkochen, Germany) through the mouth and pharynx. The nearly transparent aspect of the trachea helped control this process. The clip was placed immediately after injection while the needle was still in place to avoid loss of fluid. The fetuses were returned into the amniotic sac, which was subsequently purse-string tied. The maternal abdomen was closed in 2 layers with continuous sutures (3-0 Vicryl; Ethicon Inc), and 0.5 mL of 1% lidocaine (Xylocaine; AstraZeneca, London, UK) was administered subcutaneously for postoperative pain relief. Additional rats were operated until at least 20 fetuses with left-sided CDH were obtained in each of the groups.
Fetal necropsy
On E21.5 fetuses were delivered by cesarean section under general anesthesia, weighed, and euthanized before necropsy. The presence of a left-sided diaphragmatic defect was documented and only affected fetuses were included. Lungs were dissected and weighed, and left lungs were immersed in 10% buffered formalin solution (Accustain; Sigma Diagnostics, St. Louis, MO) for histology and immunohistochemistry. Left lungs of the last 6 fetuses in each group were frozen in liquid nitrogen and stored at –80°C for molecular analysis.
Main outcome measure was Ki-67 messenger RNA (mRNA) and protein expression as an indicator of lung proliferation. Secondary outcome measures were lung-to-bodyweight (BW) ratio (LBWR), airway morphometry, density and deposition of elastin, and the mRNA expression of its soluble precursor tropoelastin, as well as fetal survival.
RNA extraction and polymerase chain reaction
To obtain total RNA, frozen left lungs were processed in a 1-step homogenization-lysis procedure using the Tripure isolation reagent (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s protocol. A 1-step quantitative reverse transcriptase-polymerase chain reaction (PCR) was performed using the Superscript III Platinum SYBR Green Kit (Invitrogen Corp, Carlsbad, CA) on the ABI Prism 7000 detection system (Applied Biosystems, Foster City, CA) following the supplied protocol. Conditions for PCR were 30 minutes at 42°C, 5 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. mRNA content was calculated using individual standard curves and was normalized to glyceraldehyde 3-phosphate dehydrogenase mRNA expression as endogenous control. Primers for the genes of interest were initially tested by 1-step semiquantitative reverse transcriptase PCR using the Illustra ready-to-go RT-PCR Beads Kit (GE Healthcare Bio-Science, Uppsala, Sweden). Primer sequences used are provided in Table 1 .
| Primer | Sequence | Size (bp) | Gene bank reference |
|---|---|---|---|
| GAPDH | 77 | ref|XR_009325.1| | |
| Forward | TGTGTCCGTCGTGGATCTGA | ||
| Reverse | CCTGCTTCACCACCTTCTTGA | ||
| Ki-67 | 156 | ref|NW_047563.2| | |
| Forward | CCGCCAATCCAACTCAAGTAA | ||
| Reverse | TTCCAAGTGACTTTCTCGGGA | ||
| Tropoelastin | 369 | ref|NM_012722.1| | |
| Forward | TGGAGCCCTGGGATATCAAG | ||
| Reverse | GAAGCACCAACATGTAGCAC |
Immunohistochemistry for Ki-67 quantification
Formalin-preserved left lungs were embedded in paraffin, and 5-μm sections were cut through the entire lung, deparaffinized in toluene, and hydrated by ethanol before blocking of endogenous peroxidases by methanol, sodium azide, and 3% hydrogen peroxide for 30 minutes. After heat-induced epitope retrieval (2-hour water bath at >90°C in Tris-HCl plus 1 mmol/L EDTA), tissues were incubated with normal goat serum (1:25; Dako Cytomation, Carpinteria, CA) for 30 minutes at room temperature, with the primary antibody (Ki-67 monoclonal mouse anti-rat, clone MIB-5, 1:50; Dako Cytomation) at 4°C overnight, and with the secondary antibody (Envision Plus; Dako Cytomation) for 30 minutes. Sections were finally treated with 3′, 3-diaminobenzidine chromogen for 10 minutes and counterstained with hematoxylin. The number of Ki-67-positive alveolar epithelial cells was counted by using an ocular with grid (0.0036 mm) in 10 nonoverlapping fields/lung at a magnification of ×400 (Axioskop 50; Zeiss). The density of Ki-67-positive alveolar epithelial cells/mm 2 of tissue was then recalculated. Briefly, the sum of positive cells/field was multiplied by a shrinkage factor (0.612), the number of counted grids, and the airspace-tissue fraction.
Elastin detection and airway morphometry
Sections were stained using the method of Miller for visualization of elastic fibers. Images were captured (AxioCam, MRc5; Zeiss) at ×400 and the density of elastic fibers determined by using software (Image Pro Plus 4.5; Media Cybernetics Inc, Bethesda, MD). Proportion of elastic fibers was measured in 10 fields/lung and tissue surface area was calculated by subtracting airspace surface area from total surface area. The spatial distribution of elastin deposition was qualitatively assessed.
For airway morphometry sections were stained with hematoxylin-eosin and examinations were performed by light microscopy (Axioskop 50; Zeiss) at magnifications of ×200. Mean terminal bronchiolar density (MTBD) (which is inversely related to the number of saccules) and the 2 components of the mean linear intercept (Lm)—namely, the mean transsection length/airspace, which reflects the thickness of the septal wall (Lm wall [Lmw]), and the mean airspace cord length, reflecting the internal diameter of the airspace (Lm air [Lma])—were assessed.
Statistical analyses
Statistical analyses were performed with JMP 7 (SAS Institute, Cary, NC) and Prism 5 (GraphPad Software Inc, La Jolla, CA) using 1-way analysis of variance with 2-sided t test and Tukey-Kramer posttest for 4-level analyses. To determine differences in survival we used contingency tables and χ 2 analyses. Significance level was set as α = 0.05 with a 95% confidence interval. Data are presented as means with standard deviation (SD).
Results
The number of fetuses involved at fetal surgery, survivors at cesarean section (348/420; 82.9%), and gross anatomy of surviving fetuses with left-sided CDH (172/348; 49.4%) are presented in Table 2 . There was a notable decrease in fetal survival after TO (48/58; 82.75%) and intratracheal agent administration that was more pronounced after albumin (47/90; 52.2%) than saline (40/59; 67.8%) injection. The χ 2 analyses of contingency tables including these 3 groups revealed significant differences in survival ( P = .0006).
| Intervention | Operated E19 | Survivors E21 | Survivors with CDH | BW (mg) | LW (mg) | LBWR | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| n | n | % | n | % | Mean | SD | Mean | SD | Mean | SD | |
| None (control) | 213 | 213 | 100 | 110 | 51.6 | 4400.8 | 601.2 | 84.4 | 15.9 | 0.0192 | 0.0027 |
| TO | 58 | 48 | 82.8 | 20 | 41.7 | 3948.2 | 446.1 | 175.0 | 31.3 | 0.0443 | 0.0055 |
| TO-Sal | 59 | 40 | 67.8 | 20 | 50.0 | 4308.7 | 483.7 | 182.8 | 26.1 | 0.0425 | 0.0047 |
| TO-Alb | 90 | 47 | 52.3 | 22 | 46.8 | 4648.6 | 592.5 | 220.5 | 36.1 | 0.0476 | 0.0061 |
| Total | 420 | 348 | 82.86 | 172 | 49.4 | ||||||
Lung weight was significantly increased in all fetuses undergoing TO, whereas BW was comparable. The adjunct of albumin but not saline was associated with an additional gain in lung weight ( Figure 1 , A). LBWR was increased in all fetal treatment groups, again more pronounced in TO-Alb fetuses ( Figure 1 , B).
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
